Incidental Mutation 'R8781:Speg'
ID 670230
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8781 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75375297-75432320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75407021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 1218 (G1218S)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087122
AA Change: G1218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: G1218S

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113587
SMART Domains Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113588
SMART Domains Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113589
SMART Domains Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113590
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122266
SMART Domains Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A G 19: 3,717,538 D375G possibly damaging Het
Abi3bp C T 16: 56,606,149 T509I probably damaging Het
Atp13a2 T A 4: 140,996,380 C257S probably benign Het
Ccdc183 T A 2: 25,612,196 probably benign Het
Cd109 C T 9: 78,636,647 P158S probably damaging Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cog5 T A 12: 31,833,250 W393R probably damaging Het
Cyth1 C T 11: 118,182,243 R277Q probably damaging Het
Ddx54 G T 5: 120,613,152 R6L probably benign Het
Dnah8 T A 17: 30,725,104 I1765N probably damaging Het
Erp27 G A 6: 136,909,460 Q192* probably null Het
Fam81a T A 9: 70,125,099 H37L probably damaging Het
Fbn2 A G 18: 58,061,647 S1481P possibly damaging Het
Fbp1 T G 13: 62,869,017 I224L probably benign Het
Fhit A G 14: 10,421,503 V32A probably damaging Het
Gapvd1 T A 2: 34,720,686 H495L probably benign Het
Gas2l3 T C 10: 89,430,979 D33G probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm884 T A 11: 103,618,132 E1003D unknown Het
Heatr5b A T 17: 78,795,309 D1213E probably benign Het
Hsf2bp C G 17: 32,033,267 E65Q possibly damaging Het
Kif28 G T 1: 179,697,916 T937K probably benign Het
Klf6 T A 13: 5,865,072 V170D probably benign Het
Kri1 A T 9: 21,280,452 S283T Het
Lct A G 1: 128,287,524 Y1772H probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1360 A G 13: 21,674,843 S34P probably damaging Het
Olfr592 T A 7: 103,186,875 D91E probably benign Het
Olfr892-ps1 T G 9: 38,190,089 D121E probably damaging Het
Parg T A 14: 32,214,443 D518E probably benign Het
Pcx G A 19: 4,620,952 A1095T probably damaging Het
Pde1b G A 15: 103,525,300 V342M probably damaging Het
Pik3r2 C T 8: 70,769,402 G579D possibly damaging Het
Pknox1 G A 17: 31,602,863 probably benign Het
Pla2g3 C A 11: 3,488,530 T60K probably benign Het
Ppfia3 C T 7: 45,348,529 E725K possibly damaging Het
Ppl C T 16: 5,097,936 V588I possibly damaging Het
Sardh T A 2: 27,196,703 E815V possibly damaging Het
Scn7a T C 2: 66,737,431 E273G probably benign Het
Slc7a8 A T 14: 54,759,539 probably benign Het
Smg8 G A 11: 87,080,321 P875S possibly damaging Het
Sncaip T C 18: 52,906,542 S603P probably benign Het
Stk31 A T 6: 49,406,775 D92V probably damaging Het
Suco A G 1: 161,818,382 V1250A probably damaging Het
Tas2r138 A G 6: 40,612,916 V132A probably benign Het
Tcp1 T C 17: 12,924,376 I524T probably damaging Het
Tenm3 CTGCTGTGAAATG C 8: 48,342,449 probably null Het
Tln2 C A 9: 67,255,951 V1105L probably damaging Het
Tmem19 T C 10: 115,359,658 probably benign Het
Tmprss4 T C 9: 45,176,442 Y283C possibly damaging Het
Trim29 T A 9: 43,311,318 V148D probably benign Het
Trip10 C T 17: 57,255,313 A277V probably benign Het
Usp12 C A 5: 146,763,362 R61L probably benign Het
Vmn1r58 T G 7: 5,410,483 L249F probably benign Het
Vmn2r31 C T 7: 7,384,401 V724I possibly damaging Het
Vmn2r66 C T 7: 84,995,147 W685* probably null Het
Vmn2r8 A G 5: 108,797,731 I670T possibly damaging Het
Vmn2r91 T A 17: 18,085,061 M2K possibly damaging Het
Wdr12 A G 1: 60,087,141 W172R probably damaging Het
Yipf5 A T 18: 40,207,699 V200E possibly damaging Het
Zfp608 T C 18: 54,898,729 K713R probably damaging Het
Zfp768 A G 7: 127,343,304 S554P probably damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
R8898:Speg UTSW 1 75388873 missense probably damaging 1.00
R8935:Speg UTSW 1 75422606 missense probably benign 0.30
R9019:Speg UTSW 1 75429238 missense probably damaging 1.00
R9027:Speg UTSW 1 75388432 missense possibly damaging 0.67
R9066:Speg UTSW 1 75385010 missense probably damaging 0.99
R9092:Speg UTSW 1 75422734 missense probably benign 0.01
R9117:Speg UTSW 1 75387800 missense probably damaging 1.00
R9202:Speg UTSW 1 75390993 missense probably damaging 1.00
R9246:Speg UTSW 1 75384854 missense probably damaging 1.00
R9248:Speg UTSW 1 75421776 missense probably damaging 1.00
R9451:Speg UTSW 1 75417733 missense probably damaging 1.00
R9452:Speg UTSW 1 75422508 missense probably benign
R9475:Speg UTSW 1 75388091 missense probably damaging 1.00
R9476:Speg UTSW 1 75401124 missense probably damaging 0.99
R9510:Speg UTSW 1 75401124 missense probably damaging 0.99
R9519:Speg UTSW 1 75415736 missense probably damaging 1.00
R9528:Speg UTSW 1 75387803 missense possibly damaging 0.78
R9542:Speg UTSW 1 75422782 missense probably benign 0.08
R9553:Speg UTSW 1 75418001 missense probably benign 0.00
R9767:Speg UTSW 1 75427181 missense possibly damaging 0.78
R9768:Speg UTSW 1 75418973 nonsense probably null
R9800:Speg UTSW 1 75422714 missense probably benign 0.03
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCTGGGTAGCCATGTGGTTC -3'
(R):5'- CACTGTGTGGACTCAAGAAGG -3'

Sequencing Primer
(F):5'- GGTTCTTGCAGCTCGAAGC -3'
(R):5'- AAAGGCTCTGTTCCCCAGG -3'
Posted On 2021-04-30