Incidental Mutation 'R8781:Scn7a'
ID 670237
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 068605-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8781 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66567775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 273 (E273G)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably benign
Transcript: ENSMUST00000042792
AA Change: E273G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: E273G

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A G 19: 3,767,538 (GRCm39) D375G possibly damaging Het
Abi3bp C T 16: 56,426,512 (GRCm39) T509I probably damaging Het
Atp13a2 T A 4: 140,723,691 (GRCm39) C257S probably benign Het
Ccdc183 T A 2: 25,502,208 (GRCm39) probably benign Het
Cd109 C T 9: 78,543,929 (GRCm39) P158S probably damaging Het
Cdh23 C T 10: 60,167,567 (GRCm39) E1810K probably damaging Het
Cog5 T A 12: 31,883,249 (GRCm39) W393R probably damaging Het
Cyth1 C T 11: 118,073,069 (GRCm39) R277Q probably damaging Het
Ddx54 G T 5: 120,751,217 (GRCm39) R6L probably benign Het
Dnah8 T A 17: 30,944,078 (GRCm39) I1765N probably damaging Het
Erp27 G A 6: 136,886,458 (GRCm39) Q192* probably null Het
Fam81a T A 9: 70,032,381 (GRCm39) H37L probably damaging Het
Fbn2 A G 18: 58,194,719 (GRCm39) S1481P possibly damaging Het
Fbp1 T G 13: 63,016,831 (GRCm39) I224L probably benign Het
Fhit A G 14: 10,421,503 (GRCm38) V32A probably damaging Het
Gapvd1 T A 2: 34,610,698 (GRCm39) H495L probably benign Het
Gas2l3 T C 10: 89,266,841 (GRCm39) D33G probably damaging Het
Heatr5b A T 17: 79,102,738 (GRCm39) D1213E probably benign Het
Hsf2bp C G 17: 32,252,241 (GRCm39) E65Q possibly damaging Het
Kif28 G T 1: 179,525,481 (GRCm39) T937K probably benign Het
Klf6 T A 13: 5,915,071 (GRCm39) V170D probably benign Het
Kri1 A T 9: 21,191,748 (GRCm39) S283T Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Lct A G 1: 128,215,261 (GRCm39) Y1772H probably damaging Het
Lrrc37 T A 11: 103,508,958 (GRCm39) E1003D unknown Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Or2b2b A G 13: 21,859,013 (GRCm39) S34P probably damaging Het
Or52j3 T A 7: 102,836,082 (GRCm39) D91E probably benign Het
Or8c14-ps1 T G 9: 38,101,385 (GRCm39) D121E probably damaging Het
Parg T A 14: 31,936,400 (GRCm39) D518E probably benign Het
Pcx G A 19: 4,670,980 (GRCm39) A1095T probably damaging Het
Pde1b G A 15: 103,433,727 (GRCm39) V342M probably damaging Het
Pik3r2 C T 8: 71,222,046 (GRCm39) G579D possibly damaging Het
Pknox1 G A 17: 31,821,837 (GRCm39) probably benign Het
Pla2g3 C A 11: 3,438,530 (GRCm39) T60K probably benign Het
Ppfia3 C T 7: 44,997,953 (GRCm39) E725K possibly damaging Het
Ppl C T 16: 4,915,800 (GRCm39) V588I possibly damaging Het
Sardh T A 2: 27,086,715 (GRCm39) E815V possibly damaging Het
Slc7a8 A T 14: 54,996,996 (GRCm39) probably benign Het
Smg8 G A 11: 86,971,147 (GRCm39) P875S possibly damaging Het
Sncaip T C 18: 53,039,614 (GRCm39) S603P probably benign Het
Speg G A 1: 75,383,665 (GRCm39) G1218S probably damaging Het
Stk31 A T 6: 49,383,709 (GRCm39) D92V probably damaging Het
Suco A G 1: 161,645,951 (GRCm39) V1250A probably damaging Het
Tas2r138 A G 6: 40,589,850 (GRCm39) V132A probably benign Het
Tcp1 T C 17: 13,143,263 (GRCm39) I524T probably damaging Het
Tenm3 CTGCTGTGAAATG C 8: 48,795,484 (GRCm39) probably null Het
Tln2 C A 9: 67,163,233 (GRCm39) V1105L probably damaging Het
Tmem19 T C 10: 115,195,563 (GRCm39) probably benign Het
Tmprss4 T C 9: 45,087,740 (GRCm39) Y283C possibly damaging Het
Trim29 T A 9: 43,222,615 (GRCm39) V148D probably benign Het
Trip10 C T 17: 57,562,313 (GRCm39) A277V probably benign Het
Usp12 C A 5: 146,700,172 (GRCm39) R61L probably benign Het
Vmn1r58 T G 7: 5,413,482 (GRCm39) L249F probably benign Het
Vmn2r31 C T 7: 7,387,400 (GRCm39) V724I possibly damaging Het
Vmn2r66 C T 7: 84,644,355 (GRCm39) W685* probably null Het
Vmn2r8 A G 5: 108,945,597 (GRCm39) I670T possibly damaging Het
Vmn2r91 T A 17: 18,305,323 (GRCm39) M2K possibly damaging Het
Wdr12 A G 1: 60,126,300 (GRCm39) W172R probably damaging Het
Yipf5 A T 18: 40,340,752 (GRCm39) V200E possibly damaging Het
Zfp608 T C 18: 55,031,801 (GRCm39) K713R probably damaging Het
Zfp768 A G 7: 126,942,476 (GRCm39) S554P probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTTGCAAGATTTATGTTCTCCC -3'
(R):5'- AACACATGTCTTTCTTCCCAGG -3'

Sequencing Primer
(F):5'- CTCCCAATTAGCTGTCTGAAAATTGG -3'
(R):5'- GCCTGCAGTCTATTGTGATGACAC -3'
Posted On 2021-04-30