Incidental Mutation 'R8781:Pik3r2'
ID670252
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Namephosphoinositide-3-kinase regulatory subunit 2
Synonymsp85beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8781 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70768176-70776713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70769402 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 579 (G579D)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034296
AA Change: G579D

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: G579D

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A G 19: 3,717,538 D375G possibly damaging Het
Abi3bp C T 16: 56,606,149 T509I probably damaging Het
Atp13a2 T A 4: 140,996,380 C257S probably benign Het
Ccdc183 T A 2: 25,612,196 probably benign Het
Cd109 C T 9: 78,636,647 P158S probably damaging Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cog5 T A 12: 31,833,250 W393R probably damaging Het
Cyth1 C T 11: 118,182,243 R277Q probably damaging Het
Ddx54 G T 5: 120,613,152 R6L probably benign Het
Dnah8 T A 17: 30,725,104 I1765N probably damaging Het
Erp27 G A 6: 136,909,460 Q192* probably null Het
Fam81a T A 9: 70,125,099 H37L probably damaging Het
Fbn2 A G 18: 58,061,647 S1481P possibly damaging Het
Fbp1 T G 13: 62,869,017 I224L probably benign Het
Fhit A G 14: 10,421,503 V32A probably damaging Het
Gapvd1 T A 2: 34,720,686 H495L probably benign Het
Gas2l3 T C 10: 89,430,979 D33G probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm884 T A 11: 103,618,132 E1003D unknown Het
Heatr5b A T 17: 78,795,309 D1213E probably benign Het
Hsf2bp C G 17: 32,033,267 E65Q possibly damaging Het
Kif28 G T 1: 179,697,916 T937K probably benign Het
Klf6 T A 13: 5,865,072 V170D probably benign Het
Kri1 A T 9: 21,280,452 S283T Het
Lct A G 1: 128,287,524 Y1772H probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1360 A G 13: 21,674,843 S34P probably damaging Het
Olfr592 T A 7: 103,186,875 D91E probably benign Het
Olfr892-ps1 T G 9: 38,190,089 D121E probably damaging Het
Parg T A 14: 32,214,443 D518E probably benign Het
Pcx G A 19: 4,620,952 A1095T probably damaging Het
Pde1b G A 15: 103,525,300 V342M probably damaging Het
Pknox1 G A 17: 31,602,863 probably benign Het
Pla2g3 C A 11: 3,488,530 T60K probably benign Het
Ppfia3 C T 7: 45,348,529 E725K possibly damaging Het
Ppl C T 16: 5,097,936 V588I possibly damaging Het
Sardh T A 2: 27,196,703 E815V possibly damaging Het
Scn7a T C 2: 66,737,431 E273G probably benign Het
Slc7a8 A T 14: 54,759,539 probably benign Het
Smg8 G A 11: 87,080,321 P875S possibly damaging Het
Sncaip T C 18: 52,906,542 S603P probably benign Het
Speg G A 1: 75,407,021 G1218S probably damaging Het
Stk31 A T 6: 49,406,775 D92V probably damaging Het
Suco A G 1: 161,818,382 V1250A probably damaging Het
Tas2r138 A G 6: 40,612,916 V132A probably benign Het
Tcp1 T C 17: 12,924,376 I524T probably damaging Het
Tenm3 CTGCTGTGAAATG C 8: 48,342,449 probably null Het
Tln2 C A 9: 67,255,951 V1105L probably damaging Het
Tmem19 T C 10: 115,359,658 probably benign Het
Tmprss4 T C 9: 45,176,442 Y283C possibly damaging Het
Trim29 T A 9: 43,311,318 V148D probably benign Het
Trip10 C T 17: 57,255,313 A277V probably benign Het
Usp12 C A 5: 146,763,362 R61L probably benign Het
Vmn1r58 T G 7: 5,410,483 L249F probably benign Het
Vmn2r31 C T 7: 7,384,401 V724I possibly damaging Het
Vmn2r66 C T 7: 84,995,147 W685* probably null Het
Vmn2r8 A G 5: 108,797,731 I670T possibly damaging Het
Vmn2r91 T A 17: 18,085,061 M2K possibly damaging Het
Wdr12 A G 1: 60,087,141 W172R probably damaging Het
Yipf5 A T 18: 40,207,699 V200E possibly damaging Het
Zfp608 T C 18: 54,898,729 K713R probably damaging Het
Zfp768 A G 7: 127,343,304 S554P probably damaging Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
kingfisher UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70769986 missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70772136 nonsense probably null
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70770414 missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70769764 missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 70772367 missense probably benign 0.14
R8237:Pik3r2 UTSW 8 70772150 missense probably benign 0.00
R8414:Pik3r2 UTSW 8 70770435 missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 70774668 missense probably benign
R8794:Pik3r2 UTSW 8 70771363 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTGATCTTGCCCACGTAC -3'
(R):5'- ACCAGTACCTCGTGTGAGTC -3'

Sequencing Primer
(F):5'- GTCCTCATCCTCCATCAGTGAATAC -3'
(R):5'- GTGAGTCGCACCCTCTCCTG -3'
Posted On2021-04-30