Incidental Mutation 'R0550:Cnih3'
ID 67026
Institutional Source Beutler Lab
Gene Symbol Cnih3
Ensembl Gene ENSMUSG00000026514
Gene Name cornichon family AMPA receptor auxiliary protein 3
Synonyms 2900075G08Rik
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0550 (G1)
Quality Score 113
Status Validated
Chromosome 1
Chromosomal Location 181180193-181288206 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TTGACGAG to T at 181234042 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027795] [ENSMUST00000161880] [ENSMUST00000162685] [ENSMUST00000209607]
AlphaFold Q6ZWS4
Predicted Effect probably null
Transcript: ENSMUST00000027795
SMART Domains Protein: ENSMUSP00000027795
Gene: ENSMUSG00000026514

DomainStartEndE-ValueType
Pfam:Cornichon 1 52 6.3e-13 PFAM
Pfam:Cornichon 53 152 1.3e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161880
SMART Domains Protein: ENSMUSP00000124611
Gene: ENSMUSG00000026514

DomainStartEndE-ValueType
Pfam:Cornichon 7 64 7.2e-14 PFAM
Pfam:Cornichon 80 170 4.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162685
SMART Domains Protein: ENSMUSP00000124247
Gene: ENSMUSG00000026514

DomainStartEndE-ValueType
Pfam:Cornichon 1 111 9.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209607
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in neurons exhibti normal AMPAR- and NMDAR-evoked excitatory postsynaptic currentsAMPAR- and NMDAR-evoked excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Cnih3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02132:Cnih3 APN 1 181,282,274 (GRCm39) nonsense probably null
IGL02391:Cnih3 APN 1 181,234,078 (GRCm39) missense probably damaging 1.00
IGL02588:Cnih3 APN 1 181,237,269 (GRCm39) missense probably benign
mazola UTSW 1 181,282,186 (GRCm39) nonsense probably null
tassel UTSW 1 181,237,437 (GRCm39) intron probably benign
BB003:Cnih3 UTSW 1 181,277,566 (GRCm39) missense probably damaging 1.00
BB013:Cnih3 UTSW 1 181,277,566 (GRCm39) missense probably damaging 1.00
R0119:Cnih3 UTSW 1 181,282,309 (GRCm39) splice site probably benign
R1853:Cnih3 UTSW 1 181,282,186 (GRCm39) nonsense probably null
R1854:Cnih3 UTSW 1 181,282,186 (GRCm39) nonsense probably null
R1855:Cnih3 UTSW 1 181,282,186 (GRCm39) nonsense probably null
R1857:Cnih3 UTSW 1 181,277,638 (GRCm39) missense probably damaging 0.98
R7926:Cnih3 UTSW 1 181,277,566 (GRCm39) missense probably damaging 1.00
R8885:Cnih3 UTSW 1 181,237,437 (GRCm39) intron probably benign
R9325:Cnih3 UTSW 1 181,181,072 (GRCm39) critical splice donor site probably null
R9428:Cnih3 UTSW 1 181,180,857 (GRCm39) unclassified probably benign
Predicted Primers
Posted On 2013-08-20