Mutagenetix > Incidental Mutation

Incidental Mutation 'R8781:Cog5'

670267

Institutional Source

Beutler Lab

Gene Symbol

Cog5

Ensembl Gene

ENSMUSG00000035933

Gene Name

component of oligomeric golgi complex 5

Synonyms

5430405C01Rik, GOLTC1, GTC90

MMRRC Submission

Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene?

Probably essential (E-score: 0.835) question?

Stock #

R8781 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31654869-31937630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31833250 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 393 (W393R)

Ref Sequence

ENSEMBL: ENSMUSP00000044797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036862]

AlphaFold

Q8C0L8

Predicted Effect

probably damaging
Transcript: ENSMUST00000036862
AA Change: W393R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: W393R

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
Pfam:COG5	35	158	3.8e-37	PFAM
Pfam:Vps51	37	120	1.8e-12	PFAM

Meta Mutation Damage Score

0.4340

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]

Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	G	19: 3,717,538	D375G	possibly damaging	Het
Abi3bp	C	T	16: 56,606,149	T509I	probably damaging	Het
Atp13a2	T	A	4: 140,996,380	C257S	probably benign	Het
Ccdc183	T	A	2: 25,612,196		probably benign	Het
Cd109	C	T	9: 78,636,647	P158S	probably damaging	Het
Cdh23	C	T	10: 60,331,788	E1810K	probably damaging	Het
Cyth1	C	T	11: 118,182,243	R277Q	probably damaging	Het
Ddx54	G	T	5: 120,613,152	R6L	probably benign	Het
Dnah8	T	A	17: 30,725,104	I1765N	probably damaging	Het
Erp27	G	A	6: 136,909,460	Q192*	probably null	Het
Fam81a	T	A	9: 70,125,099	H37L	probably damaging	Het
Fbn2	A	G	18: 58,061,647	S1481P	possibly damaging	Het
Fbp1	T	G	13: 62,869,017	I224L	probably benign	Het
Fhit	A	G	14: 10,421,503	V32A	probably damaging	Het
Gapvd1	T	A	2: 34,720,686	H495L	probably benign	Het
Gas2l3	T	C	10: 89,430,979	D33G	probably damaging	Het
Gm340	C	T	19: 41,585,259	R818W	probably damaging	Het
Gm884	T	A	11: 103,618,132	E1003D	unknown	Het
Heatr5b	A	T	17: 78,795,309	D1213E	probably benign	Het
Hsf2bp	C	G	17: 32,033,267	E65Q	possibly damaging	Het
Kif28	G	T	1: 179,697,916	T937K	probably benign	Het
Klf6	T	A	13: 5,865,072	V170D	probably benign	Het
Kri1	A	T	9: 21,280,452	S283T		Het
Lct	A	G	1: 128,287,524	Y1772H	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Olfr1360	A	G	13: 21,674,843	S34P	probably damaging	Het
Olfr592	T	A	7: 103,186,875	D91E	probably benign	Het
Olfr892-ps1	T	G	9: 38,190,089	D121E	probably damaging	Het
Parg	T	A	14: 32,214,443	D518E	probably benign	Het
Pcx	G	A	19: 4,620,952	A1095T	probably damaging	Het
Pde1b	G	A	15: 103,525,300	V342M	probably damaging	Het
Pik3r2	C	T	8: 70,769,402	G579D	possibly damaging	Het
Pknox1	G	A	17: 31,602,863		probably benign	Het
Pla2g3	C	A	11: 3,488,530	T60K	probably benign	Het
Ppfia3	C	T	7: 45,348,529	E725K	possibly damaging	Het
Ppl	C	T	16: 5,097,936	V588I	possibly damaging	Het
Sardh	T	A	2: 27,196,703	E815V	possibly damaging	Het
Scn7a	T	C	2: 66,737,431	E273G	probably benign	Het
Slc7a8	A	T	14: 54,759,539		probably benign	Het
Smg8	G	A	11: 87,080,321	P875S	possibly damaging	Het
Sncaip	T	C	18: 52,906,542	S603P	probably benign	Het
Speg	G	A	1: 75,407,021	G1218S	probably damaging	Het
Stk31	A	T	6: 49,406,775	D92V	probably damaging	Het
Suco	A	G	1: 161,818,382	V1250A	probably damaging	Het
Tas2r138	A	G	6: 40,612,916	V132A	probably benign	Het
Tcp1	T	C	17: 12,924,376	I524T	probably damaging	Het
Tenm3	CTGCTGTGAAATG	C	8: 48,342,449		probably null	Het
Tln2	C	A	9: 67,255,951	V1105L	probably damaging	Het
Tmem19	T	C	10: 115,359,658		probably benign	Het
Tmprss4	T	C	9: 45,176,442	Y283C	possibly damaging	Het
Trim29	T	A	9: 43,311,318	V148D	probably benign	Het
Trip10	C	T	17: 57,255,313	A277V	probably benign	Het
Usp12	C	A	5: 146,763,362	R61L	probably benign	Het
Vmn1r58	T	G	7: 5,410,483	L249F	probably benign	Het
Vmn2r31	C	T	7: 7,384,401	V724I	possibly damaging	Het
Vmn2r66	C	T	7: 84,995,147	W685*	probably null	Het
Vmn2r8	A	G	5: 108,797,731	I670T	possibly damaging	Het
Vmn2r91	T	A	17: 18,085,061	M2K	possibly damaging	Het
Wdr12	A	G	1: 60,087,141	W172R	probably damaging	Het
Yipf5	A	T	18: 40,207,699	V200E	possibly damaging	Het
Zfp608	T	C	18: 54,898,729	K713R	probably damaging	Het
Zfp768	A	G	7: 127,343,304	S554P	probably damaging	Het

Other mutations in Cog5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cog5	APN	12	31685704	missense	probably damaging	1.00
IGL00495:Cog5	APN	12	31837309	missense	probably benign	0.06
IGL00763:Cog5	APN	12	31665532	splice site	probably benign
IGL00789:Cog5	APN	12	31760952	missense	possibly damaging	0.95
IGL01288:Cog5	APN	12	31886206	missense	probably benign	0.13
IGL01315:Cog5	APN	12	31760986	splice site	probably benign
IGL01396:Cog5	APN	12	31894096	missense	probably benign	0.01
IGL02468:Cog5	APN	12	31837358	critical splice donor site	probably null
IGL03030:Cog5	APN	12	31790922	missense	probably damaging	0.99
IGL03346:Cog5	APN	12	31894038	missense	possibly damaging	0.88
R0201:Cog5	UTSW	12	31839841	missense	probably damaging	0.99
R0356:Cog5	UTSW	12	31837181	splice site	probably benign
R0492:Cog5	UTSW	12	31869461	missense	probably damaging	1.00
R0646:Cog5	UTSW	12	31837359	splice site	probably benign
R0971:Cog5	UTSW	12	31919678	missense	probably benign	0.11
R1158:Cog5	UTSW	12	31870057	splice site	probably benign
R1997:Cog5	UTSW	12	31660849	missense	possibly damaging	0.66
R2167:Cog5	UTSW	12	31837289	missense	probably damaging	0.99
R4414:Cog5	UTSW	12	31660854	nonsense	probably null
R4755:Cog5	UTSW	12	31869406	splice site	probably null
R4836:Cog5	UTSW	12	31919733	missense	probably benign	0.07
R5017:Cog5	UTSW	12	31920605	missense	probably benign	0.29
R5256:Cog5	UTSW	12	31886205	missense	probably benign
R5986:Cog5	UTSW	12	31660717	missense	probably benign	0.03
R6131:Cog5	UTSW	12	31886221	missense	possibly damaging	0.47
R6885:Cog5	UTSW	12	31894199	missense	probably damaging	1.00
R7056:Cog5	UTSW	12	31665469	missense	possibly damaging	0.65
R7177:Cog5	UTSW	12	31760889	missense	probably damaging	1.00
R7182:Cog5	UTSW	12	31685708	missense	probably damaging	1.00
R7418:Cog5	UTSW	12	31833241	missense	probably damaging	1.00
R7445:Cog5	UTSW	12	31919672	missense	possibly damaging	0.64
R7585:Cog5	UTSW	12	31760889	missense	probably damaging	1.00
R8332:Cog5	UTSW	12	31833223	nonsense	probably null
R8722:Cog5	UTSW	12	31919704	missense	possibly damaging	0.82
R8911:Cog5	UTSW	12	31833239	missense	probably damaging	1.00
R8979:Cog5	UTSW	12	31790895	missense	probably benign	0.00
R9153:Cog5	UTSW	12	31660811	missense	possibly damaging	0.87
X0062:Cog5	UTSW	12	31685692	missense	probably benign	0.01
Z1177:Cog5	UTSW	12	31801985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCTCAGATTATATGGGTTTCGAC -3'
(R):5'- CCATTCTGGTAGCAGGTATAATGC -3'

Sequencing Primer
(F):5'- ATCCAGTGAATTTCAAAGGTGTC -3'
(R):5'- CAGGTATAATGCTAAGCCACAGGTC -3'

Posted On

2021-04-30