Incidental Mutation 'R8781:Cog5'
ID 670267
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Name component of oligomeric golgi complex 5
Synonyms 5430405C01Rik, GOLTC1, GTC90
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock # R8781 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 31654869-31937630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31833250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 393 (W393R)
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862]
AlphaFold Q8C0L8
Predicted Effect probably damaging
Transcript: ENSMUST00000036862
AA Change: W393R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: W393R

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Meta Mutation Damage Score 0.4340 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A G 19: 3,717,538 D375G possibly damaging Het
Abi3bp C T 16: 56,606,149 T509I probably damaging Het
Atp13a2 T A 4: 140,996,380 C257S probably benign Het
Ccdc183 T A 2: 25,612,196 probably benign Het
Cd109 C T 9: 78,636,647 P158S probably damaging Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cyth1 C T 11: 118,182,243 R277Q probably damaging Het
Ddx54 G T 5: 120,613,152 R6L probably benign Het
Dnah8 T A 17: 30,725,104 I1765N probably damaging Het
Erp27 G A 6: 136,909,460 Q192* probably null Het
Fam81a T A 9: 70,125,099 H37L probably damaging Het
Fbn2 A G 18: 58,061,647 S1481P possibly damaging Het
Fbp1 T G 13: 62,869,017 I224L probably benign Het
Fhit A G 14: 10,421,503 V32A probably damaging Het
Gapvd1 T A 2: 34,720,686 H495L probably benign Het
Gas2l3 T C 10: 89,430,979 D33G probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm884 T A 11: 103,618,132 E1003D unknown Het
Heatr5b A T 17: 78,795,309 D1213E probably benign Het
Hsf2bp C G 17: 32,033,267 E65Q possibly damaging Het
Kif28 G T 1: 179,697,916 T937K probably benign Het
Klf6 T A 13: 5,865,072 V170D probably benign Het
Kri1 A T 9: 21,280,452 S283T Het
Lct A G 1: 128,287,524 Y1772H probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1360 A G 13: 21,674,843 S34P probably damaging Het
Olfr592 T A 7: 103,186,875 D91E probably benign Het
Olfr892-ps1 T G 9: 38,190,089 D121E probably damaging Het
Parg T A 14: 32,214,443 D518E probably benign Het
Pcx G A 19: 4,620,952 A1095T probably damaging Het
Pde1b G A 15: 103,525,300 V342M probably damaging Het
Pik3r2 C T 8: 70,769,402 G579D possibly damaging Het
Pknox1 G A 17: 31,602,863 probably benign Het
Pla2g3 C A 11: 3,488,530 T60K probably benign Het
Ppfia3 C T 7: 45,348,529 E725K possibly damaging Het
Ppl C T 16: 5,097,936 V588I possibly damaging Het
Sardh T A 2: 27,196,703 E815V possibly damaging Het
Scn7a T C 2: 66,737,431 E273G probably benign Het
Slc7a8 A T 14: 54,759,539 probably benign Het
Smg8 G A 11: 87,080,321 P875S possibly damaging Het
Sncaip T C 18: 52,906,542 S603P probably benign Het
Speg G A 1: 75,407,021 G1218S probably damaging Het
Stk31 A T 6: 49,406,775 D92V probably damaging Het
Suco A G 1: 161,818,382 V1250A probably damaging Het
Tas2r138 A G 6: 40,612,916 V132A probably benign Het
Tcp1 T C 17: 12,924,376 I524T probably damaging Het
Tenm3 CTGCTGTGAAATG C 8: 48,342,449 probably null Het
Tln2 C A 9: 67,255,951 V1105L probably damaging Het
Tmem19 T C 10: 115,359,658 probably benign Het
Tmprss4 T C 9: 45,176,442 Y283C possibly damaging Het
Trim29 T A 9: 43,311,318 V148D probably benign Het
Trip10 C T 17: 57,255,313 A277V probably benign Het
Usp12 C A 5: 146,763,362 R61L probably benign Het
Vmn1r58 T G 7: 5,410,483 L249F probably benign Het
Vmn2r31 C T 7: 7,384,401 V724I possibly damaging Het
Vmn2r66 C T 7: 84,995,147 W685* probably null Het
Vmn2r8 A G 5: 108,797,731 I670T possibly damaging Het
Vmn2r91 T A 17: 18,085,061 M2K possibly damaging Het
Wdr12 A G 1: 60,087,141 W172R probably damaging Het
Yipf5 A T 18: 40,207,699 V200E possibly damaging Het
Zfp608 T C 18: 54,898,729 K713R probably damaging Het
Zfp768 A G 7: 127,343,304 S554P probably damaging Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31685704 missense probably damaging 1.00
IGL00495:Cog5 APN 12 31837309 missense probably benign 0.06
IGL00763:Cog5 APN 12 31665532 splice site probably benign
IGL00789:Cog5 APN 12 31760952 missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31886206 missense probably benign 0.13
IGL01315:Cog5 APN 12 31760986 splice site probably benign
IGL01396:Cog5 APN 12 31894096 missense probably benign 0.01
IGL02468:Cog5 APN 12 31837358 critical splice donor site probably null
IGL03030:Cog5 APN 12 31790922 missense probably damaging 0.99
IGL03346:Cog5 APN 12 31894038 missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31839841 missense probably damaging 0.99
R0356:Cog5 UTSW 12 31837181 splice site probably benign
R0492:Cog5 UTSW 12 31869461 missense probably damaging 1.00
R0646:Cog5 UTSW 12 31837359 splice site probably benign
R0971:Cog5 UTSW 12 31919678 missense probably benign 0.11
R1158:Cog5 UTSW 12 31870057 splice site probably benign
R1997:Cog5 UTSW 12 31660849 missense possibly damaging 0.66
R2167:Cog5 UTSW 12 31837289 missense probably damaging 0.99
R4414:Cog5 UTSW 12 31660854 nonsense probably null
R4755:Cog5 UTSW 12 31869406 splice site probably null
R4836:Cog5 UTSW 12 31919733 missense probably benign 0.07
R5017:Cog5 UTSW 12 31920605 missense probably benign 0.29
R5256:Cog5 UTSW 12 31886205 missense probably benign
R5986:Cog5 UTSW 12 31660717 missense probably benign 0.03
R6131:Cog5 UTSW 12 31886221 missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31894199 missense probably damaging 1.00
R7056:Cog5 UTSW 12 31665469 missense possibly damaging 0.65
R7177:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R7182:Cog5 UTSW 12 31685708 missense probably damaging 1.00
R7418:Cog5 UTSW 12 31833241 missense probably damaging 1.00
R7445:Cog5 UTSW 12 31919672 missense possibly damaging 0.64
R7585:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R8332:Cog5 UTSW 12 31833223 nonsense probably null
R8722:Cog5 UTSW 12 31919704 missense possibly damaging 0.82
R8911:Cog5 UTSW 12 31833239 missense probably damaging 1.00
R8979:Cog5 UTSW 12 31790895 missense probably benign 0.00
R9153:Cog5 UTSW 12 31660811 missense possibly damaging 0.87
X0062:Cog5 UTSW 12 31685692 missense probably benign 0.01
Z1177:Cog5 UTSW 12 31801985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCAGATTATATGGGTTTCGAC -3'
(R):5'- CCATTCTGGTAGCAGGTATAATGC -3'

Sequencing Primer
(F):5'- ATCCAGTGAATTTCAAAGGTGTC -3'
(R):5'- CAGGTATAATGCTAAGCCACAGGTC -3'
Posted On 2021-04-30