Incidental Mutation 'R8782:Caprin1'
ID670299
Institutional Source Beutler Lab
Gene Symbol Caprin1
Ensembl Gene ENSMUSG00000027184
Gene Namecell cycle associated protein 1
Synonymscaprin-1, RNG105, MMGPIP137, Gpiap1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R8782 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location103762941-103797649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103772788 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 477 (T477S)
Ref Sequence ENSEMBL: ENSMUSP00000028607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028607] [ENSMUST00000111147] [ENSMUST00000145606]
Predicted Effect probably benign
Transcript: ENSMUST00000028607
AA Change: T477S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028607
Gene: ENSMUSG00000027184
AA Change: T477S

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 681 1.4e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111147
AA Change: T477S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106777
Gene: ENSMUSG00000027184
AA Change: T477S

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 680 2.4e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143188
SMART Domains Protein: ENSMUSP00000114423
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Caprin-1_C 178 254 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143349
SMART Domains Protein: ENSMUSP00000117733
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 202 8.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145606
SMART Domains Protein: ENSMUSP00000119327
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 33 2.9e-11 PFAM
Pfam:Caprin-1_C 32 82 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fetal size, bent posture, cyanosis, respiratory failure, and neonatal lethality with impaired neuronal network development and reduced dendritic localization of sodium potassium ATPase subunit isoform mRNAs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 56,002,958 probably null Het
Abhd16b G T 2: 181,494,415 R370L probably benign Het
Acox2 T A 14: 8,250,035 T342S probably damaging Het
Adamts12 A T 15: 11,237,592 Q329L probably damaging Het
Aimp1 T C 3: 132,667,481 M233V possibly damaging Het
Atg16l1 A G 1: 87,786,288 T474A possibly damaging Het
Atp1a1 T C 3: 101,594,217 T57A possibly damaging Het
Bcat2 A G 7: 45,585,493 D205G probably benign Het
Brd1 G T 15: 88,730,631 C20* probably null Het
Camsap2 T C 1: 136,277,219 M519V Het
Cdk5rap2 G T 4: 70,243,475 Q1516K possibly damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chat A T 14: 32,424,198 D339E probably benign Het
Col28a1 G A 6: 8,175,227 S207F unknown Het
Commd10 T A 18: 46,963,742 L72Q probably damaging Het
Crim1 T C 17: 78,200,877 C37R probably damaging Het
Csgalnact1 T A 8: 68,358,655 K454N probably damaging Het
Ctif G T 18: 75,521,797 H219Q probably benign Het
Ddx10 A T 9: 53,235,288 F211L probably damaging Het
Dhrs2 A T 14: 55,236,081 I66F possibly damaging Het
Dmtf1 A T 5: 9,129,168 D343E probably damaging Het
Fam120b A T 17: 15,402,210 Q150L probably damaging Het
Fam217a G A 13: 34,911,050 P242L probably benign Het
Gcnt2 A G 13: 40,918,753 T291A probably damaging Het
Gm14305 T G 2: 176,721,420 C368W possibly damaging Het
Gpr158 A G 2: 21,399,338 D307G probably damaging Het
Hcls1 A G 16: 36,957,301 M261V probably benign Het
Hmcn1 A G 1: 150,664,885 M2891T probably benign Het
Ighv1-31 A T 12: 114,829,685 W5R possibly damaging Het
Impg2 A G 16: 56,259,455 T541A probably damaging Het
Ints1 A T 5: 139,759,197 L1452Q probably benign Het
Kcnc2 T A 10: 112,456,532 S542T probably benign Het
Kif18a C T 2: 109,296,773 R351C probably damaging Het
Lactbl1 T G 4: 136,631,018 L100R possibly damaging Het
Loxl3 T C 6: 83,048,070 S260P probably benign Het
Lrba A T 3: 86,642,669 Y2315F probably benign Het
Lrrc32 A T 7: 98,499,063 N350I probably damaging Het
Lyn C A 4: 3,783,055 F429L probably damaging Het
Matk A G 10: 81,262,460 K402E probably damaging Het
Mau2 T C 8: 70,033,195 E121G possibly damaging Het
Mrgprx2 A G 7: 48,482,551 L173P probably damaging Het
Mroh1 A G 15: 76,414,296 T369A possibly damaging Het
Myh6 A G 14: 54,949,900 L1308P possibly damaging Het
Nbeal2 T C 9: 110,630,805 D1895G probably benign Het
Ncr1 A G 7: 4,337,764 T6A probably benign Het
Neb T A 2: 52,188,773 E5819D probably benign Het
Neurod4 T C 10: 130,271,079 N109D probably damaging Het
Nsd2 A T 5: 33,843,141 M1L probably benign Het
Nwd2 A G 5: 63,725,197 Y64C probably damaging Het
Olfm2 T A 9: 20,668,205 N417Y probably damaging Het
Olfr272 T A 4: 52,911,693 M34L probably benign Het
Olfr491 A T 7: 108,317,089 H65L probably damaging Het
Oog3 T A 4: 144,159,392 D212V probably benign Het
Parp1 A G 1: 180,589,562 K637R probably benign Het
Pcdhga3 T C 18: 37,674,812 L106P probably damaging Het
Pdk4 T C 6: 5,494,962 N67S possibly damaging Het
Plcxd3 A G 15: 4,516,768 T85A probably benign Het
Plxna1 T C 6: 89,323,238 Y1621C probably damaging Het
Pnliprp1 T A 19: 58,730,593 M108K probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Prl8a1 A T 13: 27,574,028 C233S probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Sh3tc1 A T 5: 35,714,204 M328K possibly damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc35e3 A G 10: 117,744,893 Y169H probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Speer4a T A 5: 26,036,756 H124L probably benign Het
Stab2 T A 10: 86,899,821 T1299S probably benign Het
Tesmin T C 19: 3,395,965 V237A probably benign Het
Trappc11 A T 8: 47,498,666 I984N probably benign Het
Ube2q2 G A 9: 55,163,070 probably null Het
Vmn1r169 A G 7: 23,577,978 D265G possibly damaging Het
Vps13b G T 15: 35,422,337 V148L possibly damaging Het
Vwce T C 19: 10,638,127 V124A probably benign Het
Wdr60 C T 12: 116,241,712 R419H probably damaging Het
Zc3h15 G A 2: 83,661,443 R292H probably benign Het
Other mutations in Caprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Caprin1 APN 2 103775456 missense probably benign 0.00
IGL01369:Caprin1 APN 2 103768865 missense probably damaging 0.99
IGL02054:Caprin1 APN 2 103771798 splice site probably null
IGL02260:Caprin1 APN 2 103779369 missense probably damaging 1.00
IGL02526:Caprin1 APN 2 103775603 unclassified probably benign
IGL03405:Caprin1 APN 2 103779505 missense probably damaging 1.00
R0027:Caprin1 UTSW 2 103775580 unclassified probably benign
R0396:Caprin1 UTSW 2 103769569 missense probably damaging 0.99
R0603:Caprin1 UTSW 2 103796801 missense probably benign 0.01
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1558:Caprin1 UTSW 2 103775987 missense possibly damaging 0.75
R1657:Caprin1 UTSW 2 103769506 missense probably damaging 0.99
R2945:Caprin1 UTSW 2 103772809 missense probably benign 0.04
R3946:Caprin1 UTSW 2 103796766 missense probably damaging 0.99
R5208:Caprin1 UTSW 2 103769433 critical splice donor site probably null
R6108:Caprin1 UTSW 2 103776017 missense possibly damaging 0.93
R6603:Caprin1 UTSW 2 103775511 missense probably benign 0.01
R7247:Caprin1 UTSW 2 103779474 missense possibly damaging 0.63
R7338:Caprin1 UTSW 2 103779423 missense probably benign 0.01
R7624:Caprin1 UTSW 2 103772677 missense possibly damaging 0.81
R7749:Caprin1 UTSW 2 103771754 missense probably benign 0.03
R7946:Caprin1 UTSW 2 103772748 missense probably damaging 0.99
R8304:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8324:Caprin1 UTSW 2 103783181 nonsense probably null
R8547:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8549:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8946:Caprin1 UTSW 2 103778033 missense probably damaging 1.00
Z1177:Caprin1 UTSW 2 103775934 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTCAGCTCCGTTTTGAG -3'
(R):5'- AGCCATCTCATGCTACGGAG -3'

Sequencing Primer
(F):5'- AGCTCCGTTTTGAGATTCATACACAC -3'
(R):5'- AGTTCTGTTACCAAGCATCAGTTGG -3'
Posted On2021-04-30