Incidental Mutation 'R8782:Cdk5rap2'
ID 670308
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 068630-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R8782 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70161712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1516 (Q1516K)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
AA Change: Q265K

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298
AA Change: Q265K

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144099
AA Change: Q1516K

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: Q1516K

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.1401 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 55,910,242 (GRCm39) probably null Het
Abhd16b G T 2: 181,136,208 (GRCm39) R370L probably benign Het
Acox2 T A 14: 8,250,035 (GRCm38) T342S probably damaging Het
Adamts12 A T 15: 11,237,678 (GRCm39) Q329L probably damaging Het
Aimp1 T C 3: 132,373,242 (GRCm39) M233V possibly damaging Het
Atg16l1 A G 1: 87,714,010 (GRCm39) T474A possibly damaging Het
Atp1a1 T C 3: 101,501,533 (GRCm39) T57A possibly damaging Het
Bcat2 A G 7: 45,234,917 (GRCm39) D205G probably benign Het
Brd1 G T 15: 88,614,834 (GRCm39) C20* probably null Het
Camsap2 T C 1: 136,204,957 (GRCm39) M519V Het
Caprin1 T A 2: 103,603,133 (GRCm39) T477S probably benign Het
Cep97 T C 16: 55,726,084 (GRCm39) D673G probably benign Het
Chat A T 14: 32,146,155 (GRCm39) D339E probably benign Het
Col28a1 G A 6: 8,175,227 (GRCm39) S207F unknown Het
Commd10 T A 18: 47,096,809 (GRCm39) L72Q probably damaging Het
Crim1 T C 17: 78,508,306 (GRCm39) C37R probably damaging Het
Csgalnact1 T A 8: 68,811,307 (GRCm39) K454N probably damaging Het
Ctif G T 18: 75,654,868 (GRCm39) H219Q probably benign Het
Ddx10 A T 9: 53,146,588 (GRCm39) F211L probably damaging Het
Dhrs2 A T 14: 55,473,538 (GRCm39) I66F possibly damaging Het
Dmtf1 A T 5: 9,179,168 (GRCm39) D343E probably damaging Het
Dync2i1 C T 12: 116,205,332 (GRCm39) R419H probably damaging Het
Fam120b A T 17: 15,622,472 (GRCm39) Q150L probably damaging Het
Fam217a G A 13: 35,095,033 (GRCm39) P242L probably benign Het
Gcnt2 A G 13: 41,072,229 (GRCm39) T291A probably damaging Het
Gm14305 T G 2: 176,413,213 (GRCm39) C368W possibly damaging Het
Gpr158 A G 2: 21,404,149 (GRCm39) D307G probably damaging Het
Hcls1 A G 16: 36,777,663 (GRCm39) M261V probably benign Het
Hmcn1 A G 1: 150,540,636 (GRCm39) M2891T probably benign Het
Ighv1-31 A T 12: 114,793,305 (GRCm39) W5R possibly damaging Het
Impg2 A G 16: 56,079,818 (GRCm39) T541A probably damaging Het
Ints1 A T 5: 139,744,952 (GRCm39) L1452Q probably benign Het
Kcnc2 T A 10: 112,292,437 (GRCm39) S542T probably benign Het
Kif18a C T 2: 109,127,118 (GRCm39) R351C probably damaging Het
Lactbl1 T G 4: 136,358,329 (GRCm39) L100R possibly damaging Het
Loxl3 T C 6: 83,025,051 (GRCm39) S260P probably benign Het
Lrba A T 3: 86,549,976 (GRCm39) Y2315F probably benign Het
Lrrc32 A T 7: 98,148,270 (GRCm39) N350I probably damaging Het
Lyn C A 4: 3,783,055 (GRCm39) F429L probably damaging Het
Matk A G 10: 81,098,294 (GRCm39) K402E probably damaging Het
Mau2 T C 8: 70,485,845 (GRCm39) E121G possibly damaging Het
Mrgprx2 A G 7: 48,132,299 (GRCm39) L173P probably damaging Het
Mroh1 A G 15: 76,298,496 (GRCm39) T369A possibly damaging Het
Myh6 A G 14: 55,187,357 (GRCm39) L1308P possibly damaging Het
Nbeal2 T C 9: 110,459,873 (GRCm39) D1895G probably benign Het
Ncr1 A G 7: 4,340,763 (GRCm39) T6A probably benign Het
Neb T A 2: 52,078,785 (GRCm39) E5819D probably benign Het
Neurod4 T C 10: 130,106,948 (GRCm39) N109D probably damaging Het
Nsd2 A T 5: 34,000,485 (GRCm39) M1L probably benign Het
Nwd2 A G 5: 63,882,540 (GRCm39) Y64C probably damaging Het
Olfm2 T A 9: 20,579,501 (GRCm39) N417Y probably damaging Het
Oog3 T A 4: 143,885,962 (GRCm39) D212V probably benign Het
Or13c25 T A 4: 52,911,693 (GRCm39) M34L probably benign Het
Or5p1 A T 7: 107,916,296 (GRCm39) H65L probably damaging Het
Parp1 A G 1: 180,417,127 (GRCm39) K637R probably benign Het
Pcdhga3 T C 18: 37,807,865 (GRCm39) L106P probably damaging Het
Pdk4 T C 6: 5,494,962 (GRCm39) N67S possibly damaging Het
Plcxd3 A G 15: 4,546,250 (GRCm39) T85A probably benign Het
Plxna1 T C 6: 89,300,220 (GRCm39) Y1621C probably damaging Het
Pnliprp1 T A 19: 58,719,025 (GRCm39) M108K probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,552,807 (GRCm39) probably benign Het
Prl8a1 A T 13: 27,758,011 (GRCm39) C233S probably damaging Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Sgo2a T A 1: 58,056,616 (GRCm39) probably benign Het
Sh3tc1 A T 5: 35,871,548 (GRCm39) M328K possibly damaging Het
Sim1 A G 10: 50,772,165 (GRCm39) E58G probably benign Het
Slc35e3 A G 10: 117,580,798 (GRCm39) Y169H probably damaging Het
Slc8a1 T C 17: 81,955,442 (GRCm39) D532G probably damaging Het
Speer4a1 T A 5: 26,241,754 (GRCm39) H124L probably benign Het
Stab2 T A 10: 86,735,685 (GRCm39) T1299S probably benign Het
Tesmin T C 19: 3,445,965 (GRCm39) V237A probably benign Het
Trappc11 A T 8: 47,951,701 (GRCm39) I984N probably benign Het
Ube2q2 G A 9: 55,070,354 (GRCm39) probably null Het
Vmn1r169 A G 7: 23,277,403 (GRCm39) D265G possibly damaging Het
Vps13b G T 15: 35,422,483 (GRCm39) V148L possibly damaging Het
Vwce T C 19: 10,615,491 (GRCm39) V124A probably benign Het
Zc3h15 G A 2: 83,491,787 (GRCm39) R292H probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGGTCTTTTCAGAAACCCC -3'
(R):5'- GCGGTGTACCAGTGTAATAAGG -3'

Sequencing Primer
(F):5'- CCATCCTTGACCATGGTAGAAG -3'
(R):5'- GTTGGAAAACACAAATGGTATCCC -3'
Posted On 2021-04-30