Incidental Mutation 'R8782:Cdk5rap2'
ID670308
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R8782 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70243475 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1516 (Q1516K)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
AA Change: Q265K

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298
AA Change: Q265K

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144099
AA Change: Q1516K

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: Q1516K

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.1401 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 56,002,958 probably null Het
Abhd16b G T 2: 181,494,415 R370L probably benign Het
Acox2 T A 14: 8,250,035 T342S probably damaging Het
Adamts12 A T 15: 11,237,592 Q329L probably damaging Het
Aimp1 T C 3: 132,667,481 M233V possibly damaging Het
Atg16l1 A G 1: 87,786,288 T474A possibly damaging Het
Atp1a1 T C 3: 101,594,217 T57A possibly damaging Het
Bcat2 A G 7: 45,585,493 D205G probably benign Het
Brd1 G T 15: 88,730,631 C20* probably null Het
Camsap2 T C 1: 136,277,219 M519V Het
Caprin1 T A 2: 103,772,788 T477S probably benign Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chat A T 14: 32,424,198 D339E probably benign Het
Col28a1 G A 6: 8,175,227 S207F unknown Het
Commd10 T A 18: 46,963,742 L72Q probably damaging Het
Crim1 T C 17: 78,200,877 C37R probably damaging Het
Csgalnact1 T A 8: 68,358,655 K454N probably damaging Het
Ctif G T 18: 75,521,797 H219Q probably benign Het
Ddx10 A T 9: 53,235,288 F211L probably damaging Het
Dhrs2 A T 14: 55,236,081 I66F possibly damaging Het
Dmtf1 A T 5: 9,129,168 D343E probably damaging Het
Fam120b A T 17: 15,402,210 Q150L probably damaging Het
Fam217a G A 13: 34,911,050 P242L probably benign Het
Gcnt2 A G 13: 40,918,753 T291A probably damaging Het
Gm14305 T G 2: 176,721,420 C368W possibly damaging Het
Gpr158 A G 2: 21,399,338 D307G probably damaging Het
Hcls1 A G 16: 36,957,301 M261V probably benign Het
Hmcn1 A G 1: 150,664,885 M2891T probably benign Het
Ighv1-31 A T 12: 114,829,685 W5R possibly damaging Het
Impg2 A G 16: 56,259,455 T541A probably damaging Het
Ints1 A T 5: 139,759,197 L1452Q probably benign Het
Kcnc2 T A 10: 112,456,532 S542T probably benign Het
Kif18a C T 2: 109,296,773 R351C probably damaging Het
Lactbl1 T G 4: 136,631,018 L100R possibly damaging Het
Loxl3 T C 6: 83,048,070 S260P probably benign Het
Lrba A T 3: 86,642,669 Y2315F probably benign Het
Lrrc32 A T 7: 98,499,063 N350I probably damaging Het
Lyn C A 4: 3,783,055 F429L probably damaging Het
Matk A G 10: 81,262,460 K402E probably damaging Het
Mau2 T C 8: 70,033,195 E121G possibly damaging Het
Mrgprx2 A G 7: 48,482,551 L173P probably damaging Het
Mroh1 A G 15: 76,414,296 T369A possibly damaging Het
Myh6 A G 14: 54,949,900 L1308P possibly damaging Het
Nbeal2 T C 9: 110,630,805 D1895G probably benign Het
Ncr1 A G 7: 4,337,764 T6A probably benign Het
Neb T A 2: 52,188,773 E5819D probably benign Het
Neurod4 T C 10: 130,271,079 N109D probably damaging Het
Nsd2 A T 5: 33,843,141 M1L probably benign Het
Nwd2 A G 5: 63,725,197 Y64C probably damaging Het
Olfm2 T A 9: 20,668,205 N417Y probably damaging Het
Olfr272 T A 4: 52,911,693 M34L probably benign Het
Olfr491 A T 7: 108,317,089 H65L probably damaging Het
Oog3 T A 4: 144,159,392 D212V probably benign Het
Parp1 A G 1: 180,589,562 K637R probably benign Het
Pcdhga3 T C 18: 37,674,812 L106P probably damaging Het
Pdk4 T C 6: 5,494,962 N67S possibly damaging Het
Plcxd3 A G 15: 4,516,768 T85A probably benign Het
Plxna1 T C 6: 89,323,238 Y1621C probably damaging Het
Pnliprp1 T A 19: 58,730,593 M108K probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Prl8a1 A T 13: 27,574,028 C233S probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Sgo2a T A 1: 58,017,457 probably benign Het
Sh3tc1 A T 5: 35,714,204 M328K possibly damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc35e3 A G 10: 117,744,893 Y169H probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Speer4a T A 5: 26,036,756 H124L probably benign Het
Stab2 T A 10: 86,899,821 T1299S probably benign Het
Tesmin T C 19: 3,395,965 V237A probably benign Het
Trappc11 A T 8: 47,498,666 I984N probably benign Het
Ube2q2 G A 9: 55,163,070 probably null Het
Vmn1r169 A G 7: 23,577,978 D265G possibly damaging Het
Vps13b G T 15: 35,422,337 V148L possibly damaging Het
Vwce T C 19: 10,638,127 V124A probably benign Het
Wdr60 C T 12: 116,241,712 R419H probably damaging Het
Zc3h15 G A 2: 83,661,443 R292H probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70380273 missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70239325 missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70245510 splice site probably benign
R8855:Cdk5rap2 UTSW 4 70300650 missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70266805 missense probably benign 0.30
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGGTCTTTTCAGAAACCCC -3'
(R):5'- GCGGTGTACCAGTGTAATAAGG -3'

Sequencing Primer
(F):5'- CCATCCTTGACCATGGTAGAAG -3'
(R):5'- GTTGGAAAACACAAATGGTATCCC -3'
Posted On2021-04-30