Incidental Mutation 'R8782:Csgalnact1'
ID 670329
Institutional Source Beutler Lab
Gene Symbol Csgalnact1
Ensembl Gene ENSMUSG00000036356
Gene Name chondroitin sulfate N-acetylgalactosaminyltransferase 1
Synonyms CSGalNAcT-1, 4732435N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8782 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 68356781-68735146 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68358655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 454 (K454N)
Ref Sequence ENSEMBL: ENSMUSP00000077459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214]
AlphaFold Q8BJQ9
Predicted Effect probably damaging
Transcript: ENSMUST00000078350
AA Change: K454N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: K454N

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 55 505 3.5e-85 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.2e-10 PFAM
Pfam:Glyco_transf_7C 409 478 1.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130214
AA Change: K454N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: K454N

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 71 505 1.1e-59 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.6e-10 PFAM
Pfam:Glyco_transf_7C 405 478 3.4e-12 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 56,002,958 probably null Het
Abhd16b G T 2: 181,494,415 R370L probably benign Het
Acox2 T A 14: 8,250,035 T342S probably damaging Het
Adamts12 A T 15: 11,237,592 Q329L probably damaging Het
Aimp1 T C 3: 132,667,481 M233V possibly damaging Het
Atg16l1 A G 1: 87,786,288 T474A possibly damaging Het
Atp1a1 T C 3: 101,594,217 T57A possibly damaging Het
Bcat2 A G 7: 45,585,493 D205G probably benign Het
Brd1 G T 15: 88,730,631 C20* probably null Het
Camsap2 T C 1: 136,277,219 M519V Het
Caprin1 T A 2: 103,772,788 T477S probably benign Het
Cdk5rap2 G T 4: 70,243,475 Q1516K possibly damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chat A T 14: 32,424,198 D339E probably benign Het
Col28a1 G A 6: 8,175,227 S207F unknown Het
Commd10 T A 18: 46,963,742 L72Q probably damaging Het
Crim1 T C 17: 78,200,877 C37R probably damaging Het
Ctif G T 18: 75,521,797 H219Q probably benign Het
Ddx10 A T 9: 53,235,288 F211L probably damaging Het
Dhrs2 A T 14: 55,236,081 I66F possibly damaging Het
Dmtf1 A T 5: 9,129,168 D343E probably damaging Het
Fam120b A T 17: 15,402,210 Q150L probably damaging Het
Fam217a G A 13: 34,911,050 P242L probably benign Het
Gcnt2 A G 13: 40,918,753 T291A probably damaging Het
Gm14305 T G 2: 176,721,420 C368W possibly damaging Het
Gpr158 A G 2: 21,399,338 D307G probably damaging Het
Hcls1 A G 16: 36,957,301 M261V probably benign Het
Hmcn1 A G 1: 150,664,885 M2891T probably benign Het
Ighv1-31 A T 12: 114,829,685 W5R possibly damaging Het
Impg2 A G 16: 56,259,455 T541A probably damaging Het
Ints1 A T 5: 139,759,197 L1452Q probably benign Het
Kcnc2 T A 10: 112,456,532 S542T probably benign Het
Kif18a C T 2: 109,296,773 R351C probably damaging Het
Lactbl1 T G 4: 136,631,018 L100R possibly damaging Het
Loxl3 T C 6: 83,048,070 S260P probably benign Het
Lrba A T 3: 86,642,669 Y2315F probably benign Het
Lrrc32 A T 7: 98,499,063 N350I probably damaging Het
Lyn C A 4: 3,783,055 F429L probably damaging Het
Matk A G 10: 81,262,460 K402E probably damaging Het
Mau2 T C 8: 70,033,195 E121G possibly damaging Het
Mrgprx2 A G 7: 48,482,551 L173P probably damaging Het
Mroh1 A G 15: 76,414,296 T369A possibly damaging Het
Myh6 A G 14: 54,949,900 L1308P possibly damaging Het
Nbeal2 T C 9: 110,630,805 D1895G probably benign Het
Ncr1 A G 7: 4,337,764 T6A probably benign Het
Neb T A 2: 52,188,773 E5819D probably benign Het
Neurod4 T C 10: 130,271,079 N109D probably damaging Het
Nsd2 A T 5: 33,843,141 M1L probably benign Het
Nwd2 A G 5: 63,725,197 Y64C probably damaging Het
Olfm2 T A 9: 20,668,205 N417Y probably damaging Het
Olfr272 T A 4: 52,911,693 M34L probably benign Het
Olfr491 A T 7: 108,317,089 H65L probably damaging Het
Oog3 T A 4: 144,159,392 D212V probably benign Het
Parp1 A G 1: 180,589,562 K637R probably benign Het
Pcdhga3 T C 18: 37,674,812 L106P probably damaging Het
Pdk4 T C 6: 5,494,962 N67S possibly damaging Het
Plcxd3 A G 15: 4,516,768 T85A probably benign Het
Plxna1 T C 6: 89,323,238 Y1621C probably damaging Het
Pnliprp1 T A 19: 58,730,593 M108K probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Prl8a1 A T 13: 27,574,028 C233S probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Sgo2a T A 1: 58,017,457 probably benign Het
Sh3tc1 A T 5: 35,714,204 M328K possibly damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc35e3 A G 10: 117,744,893 Y169H probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Speer4a T A 5: 26,036,756 H124L probably benign Het
Stab2 T A 10: 86,899,821 T1299S probably benign Het
Tesmin T C 19: 3,395,965 V237A probably benign Het
Trappc11 A T 8: 47,498,666 I984N probably benign Het
Ube2q2 G A 9: 55,163,070 probably null Het
Vmn1r169 A G 7: 23,577,978 D265G possibly damaging Het
Vps13b G T 15: 35,422,337 V148L possibly damaging Het
Vwce T C 19: 10,638,127 V124A probably benign Het
Wdr60 C T 12: 116,241,712 R419H probably damaging Het
Zc3h15 G A 2: 83,661,443 R292H probably benign Het
Other mutations in Csgalnact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02025:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02037:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02059:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02074:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02079:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02080:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02094:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02127:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02128:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02157:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02158:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02197:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02201:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02206:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02207:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02214:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02215:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02229:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02243:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02247:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02248:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02250:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02389:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02394:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02397:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02398:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02400:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02404:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02405:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02406:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02420:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02425:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02428:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02436:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02437:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02438:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02468:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02470:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02472:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02473:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02474:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02475:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02510:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02529:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02530:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02531:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02533:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02543:Csgalnact1 APN 8 68461068 missense probably damaging 1.00
IGL02620:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02625:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02671:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02674:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02683:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02685:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02686:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02697:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02698:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02741:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02985:Csgalnact1 APN 8 68461043 missense probably benign 0.02
R0173:Csgalnact1 UTSW 8 68461029 missense probably damaging 1.00
R1594:Csgalnact1 UTSW 8 68358632 missense probably damaging 1.00
R1655:Csgalnact1 UTSW 8 68373689 missense possibly damaging 0.89
R1873:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R1955:Csgalnact1 UTSW 8 68372667 missense probably benign
R2421:Csgalnact1 UTSW 8 68461508 missense probably benign 0.42
R3195:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3196:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3951:Csgalnact1 UTSW 8 68461262 missense probably benign
R4304:Csgalnact1 UTSW 8 68372642 missense possibly damaging 0.94
R4989:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5133:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5134:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5503:Csgalnact1 UTSW 8 68461473 missense probably damaging 0.98
R5812:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R6143:Csgalnact1 UTSW 8 68373550 missense probably damaging 1.00
R6387:Csgalnact1 UTSW 8 68358713 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461109 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461110 missense probably damaging 1.00
R7023:Csgalnact1 UTSW 8 68358429 missense probably benign
R8318:Csgalnact1 UTSW 8 68461133 missense probably damaging 1.00
R8446:Csgalnact1 UTSW 8 68461091 missense probably damaging 0.99
R8519:Csgalnact1 UTSW 8 68401453 missense possibly damaging 0.65
R8674:Csgalnact1 UTSW 8 68373616 missense possibly damaging 0.91
R9210:Csgalnact1 UTSW 8 68461589 start gained probably benign
Z1088:Csgalnact1 UTSW 8 68401330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCGGAAGACAAGCATCC -3'
(R):5'- GGAGCTTCAAATAGCACCTCGC -3'

Sequencing Primer
(F):5'- ATCCCCAGCTGCCCATG -3'
(R):5'- CCCAATGGTCTGGAACTTGTCAAG -3'
Posted On 2021-04-30