Mutagenetix > Incidental Mutations

Incidental Mutation 'R8782:Csgalnact1'

670329

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R8782 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68358655 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 454 (K454N)

Ref Sequence

ENSEMBL: ENSMUSP00000077459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214]

AlphaFold

Q8BJQ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000078350
AA Change: K454N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: K454N

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130214
AA Change: K454N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: K454N

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	G	9: 56,002,958		probably null	Het
Abhd16b	G	T	2: 181,494,415	R370L	probably benign	Het
Acox2	T	A	14: 8,250,035	T342S	probably damaging	Het
Adamts12	A	T	15: 11,237,592	Q329L	probably damaging	Het
Aimp1	T	C	3: 132,667,481	M233V	possibly damaging	Het
Atg16l1	A	G	1: 87,786,288	T474A	possibly damaging	Het
Atp1a1	T	C	3: 101,594,217	T57A	possibly damaging	Het
Bcat2	A	G	7: 45,585,493	D205G	probably benign	Het
Brd1	G	T	15: 88,730,631	C20*	probably null	Het
Camsap2	T	C	1: 136,277,219	M519V		Het
Caprin1	T	A	2: 103,772,788	T477S	probably benign	Het
Cdk5rap2	G	T	4: 70,243,475	Q1516K	possibly damaging	Het
Cep97	T	C	16: 55,905,721	D673G	probably benign	Het
Chat	A	T	14: 32,424,198	D339E	probably benign	Het
Col28a1	G	A	6: 8,175,227	S207F	unknown	Het
Commd10	T	A	18: 46,963,742	L72Q	probably damaging	Het
Crim1	T	C	17: 78,200,877	C37R	probably damaging	Het
Ctif	G	T	18: 75,521,797	H219Q	probably benign	Het
Ddx10	A	T	9: 53,235,288	F211L	probably damaging	Het
Dhrs2	A	T	14: 55,236,081	I66F	possibly damaging	Het
Dmtf1	A	T	5: 9,129,168	D343E	probably damaging	Het
Fam120b	A	T	17: 15,402,210	Q150L	probably damaging	Het
Fam217a	G	A	13: 34,911,050	P242L	probably benign	Het
Gcnt2	A	G	13: 40,918,753	T291A	probably damaging	Het
Gm14305	T	G	2: 176,721,420	C368W	possibly damaging	Het
Gpr158	A	G	2: 21,399,338	D307G	probably damaging	Het
Hcls1	A	G	16: 36,957,301	M261V	probably benign	Het
Hmcn1	A	G	1: 150,664,885	M2891T	probably benign	Het
Ighv1-31	A	T	12: 114,829,685	W5R	possibly damaging	Het
Impg2	A	G	16: 56,259,455	T541A	probably damaging	Het
Ints1	A	T	5: 139,759,197	L1452Q	probably benign	Het
Kcnc2	T	A	10: 112,456,532	S542T	probably benign	Het
Kif18a	C	T	2: 109,296,773	R351C	probably damaging	Het
Lactbl1	T	G	4: 136,631,018	L100R	possibly damaging	Het
Loxl3	T	C	6: 83,048,070	S260P	probably benign	Het
Lrba	A	T	3: 86,642,669	Y2315F	probably benign	Het
Lrrc32	A	T	7: 98,499,063	N350I	probably damaging	Het
Lyn	C	A	4: 3,783,055	F429L	probably damaging	Het
Matk	A	G	10: 81,262,460	K402E	probably damaging	Het
Mau2	T	C	8: 70,033,195	E121G	possibly damaging	Het
Mrgprx2	A	G	7: 48,482,551	L173P	probably damaging	Het
Mroh1	A	G	15: 76,414,296	T369A	possibly damaging	Het
Myh6	A	G	14: 54,949,900	L1308P	possibly damaging	Het
Nbeal2	T	C	9: 110,630,805	D1895G	probably benign	Het
Ncr1	A	G	7: 4,337,764	T6A	probably benign	Het
Neb	T	A	2: 52,188,773	E5819D	probably benign	Het
Neurod4	T	C	10: 130,271,079	N109D	probably damaging	Het
Nsd2	A	T	5: 33,843,141	M1L	probably benign	Het
Nwd2	A	G	5: 63,725,197	Y64C	probably damaging	Het
Olfm2	T	A	9: 20,668,205	N417Y	probably damaging	Het
Olfr272	T	A	4: 52,911,693	M34L	probably benign	Het
Olfr491	A	T	7: 108,317,089	H65L	probably damaging	Het
Oog3	T	A	4: 144,159,392	D212V	probably benign	Het
Parp1	A	G	1: 180,589,562	K637R	probably benign	Het
Pcdhga3	T	C	18: 37,674,812	L106P	probably damaging	Het
Pdk4	T	C	6: 5,494,962	N67S	possibly damaging	Het
Plcxd3	A	G	15: 4,516,768	T85A	probably benign	Het
Plxna1	T	C	6: 89,323,238	Y1621C	probably damaging	Het
Pnliprp1	T	A	19: 58,730,593	M108K	probably damaging	Het
Pou3f1	GCACCACCACCACCACCAC	GCACCACCACCACCAC	4: 124,659,014		probably benign	Het
Prl8a1	A	T	13: 27,574,028	C233S	probably damaging	Het
R3hdm2	T	G	10: 127,457,652	S142A	probably damaging	Het
Sgo2a	T	A	1: 58,017,457		probably benign	Het
Sh3tc1	A	T	5: 35,714,204	M328K	possibly damaging	Het
Sim1	A	G	10: 50,896,069	E58G	probably benign	Het
Slc35e3	A	G	10: 117,744,893	Y169H	probably damaging	Het
Slc8a1	T	C	17: 81,648,013	D532G	probably damaging	Het
Speer4a	T	A	5: 26,036,756	H124L	probably benign	Het
Stab2	T	A	10: 86,899,821	T1299S	probably benign	Het
Tesmin	T	C	19: 3,395,965	V237A	probably benign	Het
Trappc11	A	T	8: 47,498,666	I984N	probably benign	Het
Ube2q2	G	A	9: 55,163,070		probably null	Het
Vmn1r169	A	G	7: 23,577,978	D265G	possibly damaging	Het
Vps13b	G	T	15: 35,422,337	V148L	possibly damaging	Het
Vwce	T	C	19: 10,638,127	V124A	probably benign	Het
Wdr60	C	T	12: 116,241,712	R419H	probably damaging	Het
Zc3h15	G	A	2: 83,661,443	R292H	probably benign	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1873:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R1955:Csgalnact1	UTSW	8	68372667	missense	probably benign
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3195:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4304:Csgalnact1	UTSW	8	68372642	missense	possibly damaging	0.94
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461110	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8318:Csgalnact1	UTSW	8	68461133	missense	probably damaging	1.00
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8519:Csgalnact1	UTSW	8	68401453	missense	possibly damaging	0.65
R8674:Csgalnact1	UTSW	8	68373616	missense	possibly damaging	0.91
R9210:Csgalnact1	UTSW	8	68461589	start gained	probably benign
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCGGAAGACAAGCATCC -3'
(R):5'- GGAGCTTCAAATAGCACCTCGC -3'

Sequencing Primer
(F):5'- ATCCCCAGCTGCCCATG -3'
(R):5'- CCCAATGGTCTGGAACTTGTCAAG -3'

Posted On

2021-04-30