Incidental Mutation 'R8782:Adamts12'
ID670353
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R8782 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11237592 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 329 (Q329L)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: Q329L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: Q329L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 56,002,958 probably null Het
Abhd16b G T 2: 181,494,415 R370L probably benign Het
Acox2 T A 14: 8,250,035 T342S probably damaging Het
Aimp1 T C 3: 132,667,481 M233V possibly damaging Het
Atg16l1 A G 1: 87,786,288 T474A possibly damaging Het
Atp1a1 T C 3: 101,594,217 T57A possibly damaging Het
Bcat2 A G 7: 45,585,493 D205G probably benign Het
Brd1 G T 15: 88,730,631 C20* probably null Het
Camsap2 T C 1: 136,277,219 M519V Het
Caprin1 T A 2: 103,772,788 T477S probably benign Het
Cdk5rap2 G T 4: 70,243,475 Q1516K possibly damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chat A T 14: 32,424,198 D339E probably benign Het
Col28a1 G A 6: 8,175,227 S207F unknown Het
Commd10 T A 18: 46,963,742 L72Q probably damaging Het
Crim1 T C 17: 78,200,877 C37R probably damaging Het
Csgalnact1 T A 8: 68,358,655 K454N probably damaging Het
Ctif G T 18: 75,521,797 H219Q probably benign Het
Ddx10 A T 9: 53,235,288 F211L probably damaging Het
Dhrs2 A T 14: 55,236,081 I66F possibly damaging Het
Dmtf1 A T 5: 9,129,168 D343E probably damaging Het
Fam120b A T 17: 15,402,210 Q150L probably damaging Het
Fam217a G A 13: 34,911,050 P242L probably benign Het
Gcnt2 A G 13: 40,918,753 T291A probably damaging Het
Gm14305 T G 2: 176,721,420 C368W possibly damaging Het
Gpr158 A G 2: 21,399,338 D307G probably damaging Het
Hcls1 A G 16: 36,957,301 M261V probably benign Het
Hmcn1 A G 1: 150,664,885 M2891T probably benign Het
Ighv1-31 A T 12: 114,829,685 W5R possibly damaging Het
Impg2 A G 16: 56,259,455 T541A probably damaging Het
Ints1 A T 5: 139,759,197 L1452Q probably benign Het
Kcnc2 T A 10: 112,456,532 S542T probably benign Het
Kif18a C T 2: 109,296,773 R351C probably damaging Het
Lactbl1 T G 4: 136,631,018 L100R possibly damaging Het
Loxl3 T C 6: 83,048,070 S260P probably benign Het
Lrba A T 3: 86,642,669 Y2315F probably benign Het
Lrrc32 A T 7: 98,499,063 N350I probably damaging Het
Lyn C A 4: 3,783,055 F429L probably damaging Het
Matk A G 10: 81,262,460 K402E probably damaging Het
Mau2 T C 8: 70,033,195 E121G possibly damaging Het
Mrgprx2 A G 7: 48,482,551 L173P probably damaging Het
Mroh1 A G 15: 76,414,296 T369A possibly damaging Het
Myh6 A G 14: 54,949,900 L1308P possibly damaging Het
Nbeal2 T C 9: 110,630,805 D1895G probably benign Het
Ncr1 A G 7: 4,337,764 T6A probably benign Het
Neb T A 2: 52,188,773 E5819D probably benign Het
Neurod4 T C 10: 130,271,079 N109D probably damaging Het
Nsd2 A T 5: 33,843,141 M1L probably benign Het
Nwd2 A G 5: 63,725,197 Y64C probably damaging Het
Olfm2 T A 9: 20,668,205 N417Y probably damaging Het
Olfr272 T A 4: 52,911,693 M34L probably benign Het
Olfr491 A T 7: 108,317,089 H65L probably damaging Het
Oog3 T A 4: 144,159,392 D212V probably benign Het
Parp1 A G 1: 180,589,562 K637R probably benign Het
Pcdhga3 T C 18: 37,674,812 L106P probably damaging Het
Pdk4 T C 6: 5,494,962 N67S possibly damaging Het
Plcxd3 A G 15: 4,516,768 T85A probably benign Het
Plxna1 T C 6: 89,323,238 Y1621C probably damaging Het
Pnliprp1 T A 19: 58,730,593 M108K probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Prl8a1 A T 13: 27,574,028 C233S probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Sh3tc1 A T 5: 35,714,204 M328K possibly damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc35e3 A G 10: 117,744,893 Y169H probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Speer4a T A 5: 26,036,756 H124L probably benign Het
Stab2 T A 10: 86,899,821 T1299S probably benign Het
Tesmin T C 19: 3,395,965 V237A probably benign Het
Trappc11 A T 8: 47,498,666 I984N probably benign Het
Ube2q2 G A 9: 55,163,070 probably null Het
Vmn1r169 A G 7: 23,577,978 D265G possibly damaging Het
Vps13b G T 15: 35,422,337 V148L possibly damaging Het
Vwce T C 19: 10,638,127 V124A probably benign Het
Wdr60 C T 12: 116,241,712 R419H probably damaging Het
Zc3h15 G A 2: 83,661,443 R292H probably benign Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11310818 missense probably benign
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11215727 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- AAGGTAATAAACTGGCCTCTGC -3'
(R):5'- TTCAAATGACCAAGAGCAGCAG -3'

Sequencing Primer
(F):5'- TATATCTTACAAATACCTGGAGCACC -3'
(R):5'- CAGCAGAAAATAATGAGCATCCTATG -3'
Posted On2021-04-30