Incidental Mutation 'R8782:Impg2'
ID670359
Institutional Source Beutler Lab
Gene Symbol Impg2
Ensembl Gene ENSMUSG00000035270
Gene Nameinterphotoreceptor matrix proteoglycan 2
SynonymsIPM200, Spacrcan, PG10.2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8782 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location56204313-56273756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56259455 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 541 (T541A)
Ref Sequence ENSEMBL: ENSMUSP00000063648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069936] [ENSMUST00000160116]
Predicted Effect probably damaging
Transcript: ENSMUST00000069936
AA Change: T541A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063648
Gene: ENSMUSG00000035270
AA Change: T541A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
low complexity region 396 407 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
SEA 895 1018 2.18e-28 SMART
EGF_like 1016 1054 3.57e1 SMART
EGF_like 1056 1096 3.04e1 SMART
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160116
AA Change: T432A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125135
Gene: ENSMUSG00000035270
AA Change: T432A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
SEA 786 909 2.18e-28 SMART
EGF_like 907 945 3.57e1 SMART
EGF_like 947 987 3.04e1 SMART
transmembrane domain 996 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 56,002,958 probably null Het
Abhd16b G T 2: 181,494,415 R370L probably benign Het
Acox2 T A 14: 8,250,035 T342S probably damaging Het
Adamts12 A T 15: 11,237,592 Q329L probably damaging Het
Aimp1 T C 3: 132,667,481 M233V possibly damaging Het
Atg16l1 A G 1: 87,786,288 T474A possibly damaging Het
Atp1a1 T C 3: 101,594,217 T57A possibly damaging Het
Bcat2 A G 7: 45,585,493 D205G probably benign Het
Brd1 G T 15: 88,730,631 C20* probably null Het
Camsap2 T C 1: 136,277,219 M519V Het
Caprin1 T A 2: 103,772,788 T477S probably benign Het
Cdk5rap2 G T 4: 70,243,475 Q1516K possibly damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chat A T 14: 32,424,198 D339E probably benign Het
Col28a1 G A 6: 8,175,227 S207F unknown Het
Commd10 T A 18: 46,963,742 L72Q probably damaging Het
Crim1 T C 17: 78,200,877 C37R probably damaging Het
Csgalnact1 T A 8: 68,358,655 K454N probably damaging Het
Ctif G T 18: 75,521,797 H219Q probably benign Het
Ddx10 A T 9: 53,235,288 F211L probably damaging Het
Dhrs2 A T 14: 55,236,081 I66F possibly damaging Het
Dmtf1 A T 5: 9,129,168 D343E probably damaging Het
Fam120b A T 17: 15,402,210 Q150L probably damaging Het
Fam217a G A 13: 34,911,050 P242L probably benign Het
Gcnt2 A G 13: 40,918,753 T291A probably damaging Het
Gm14305 T G 2: 176,721,420 C368W possibly damaging Het
Gpr158 A G 2: 21,399,338 D307G probably damaging Het
Hcls1 A G 16: 36,957,301 M261V probably benign Het
Hmcn1 A G 1: 150,664,885 M2891T probably benign Het
Ighv1-31 A T 12: 114,829,685 W5R possibly damaging Het
Ints1 A T 5: 139,759,197 L1452Q probably benign Het
Kcnc2 T A 10: 112,456,532 S542T probably benign Het
Kif18a C T 2: 109,296,773 R351C probably damaging Het
Lactbl1 T G 4: 136,631,018 L100R possibly damaging Het
Loxl3 T C 6: 83,048,070 S260P probably benign Het
Lrba A T 3: 86,642,669 Y2315F probably benign Het
Lrrc32 A T 7: 98,499,063 N350I probably damaging Het
Lyn C A 4: 3,783,055 F429L probably damaging Het
Matk A G 10: 81,262,460 K402E probably damaging Het
Mau2 T C 8: 70,033,195 E121G possibly damaging Het
Mrgprx2 A G 7: 48,482,551 L173P probably damaging Het
Mroh1 A G 15: 76,414,296 T369A possibly damaging Het
Myh6 A G 14: 54,949,900 L1308P possibly damaging Het
Nbeal2 T C 9: 110,630,805 D1895G probably benign Het
Ncr1 A G 7: 4,337,764 T6A probably benign Het
Neb T A 2: 52,188,773 E5819D probably benign Het
Neurod4 T C 10: 130,271,079 N109D probably damaging Het
Nsd2 A T 5: 33,843,141 M1L probably benign Het
Nwd2 A G 5: 63,725,197 Y64C probably damaging Het
Olfm2 T A 9: 20,668,205 N417Y probably damaging Het
Olfr272 T A 4: 52,911,693 M34L probably benign Het
Olfr491 A T 7: 108,317,089 H65L probably damaging Het
Oog3 T A 4: 144,159,392 D212V probably benign Het
Parp1 A G 1: 180,589,562 K637R probably benign Het
Pcdhga3 T C 18: 37,674,812 L106P probably damaging Het
Pdk4 T C 6: 5,494,962 N67S possibly damaging Het
Plcxd3 A G 15: 4,516,768 T85A probably benign Het
Plxna1 T C 6: 89,323,238 Y1621C probably damaging Het
Pnliprp1 T A 19: 58,730,593 M108K probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Prl8a1 A T 13: 27,574,028 C233S probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Sh3tc1 A T 5: 35,714,204 M328K possibly damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc35e3 A G 10: 117,744,893 Y169H probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Speer4a T A 5: 26,036,756 H124L probably benign Het
Stab2 T A 10: 86,899,821 T1299S probably benign Het
Tesmin T C 19: 3,395,965 V237A probably benign Het
Trappc11 A T 8: 47,498,666 I984N probably benign Het
Ube2q2 G A 9: 55,163,070 probably null Het
Vmn1r169 A G 7: 23,577,978 D265G possibly damaging Het
Vps13b G T 15: 35,422,337 V148L possibly damaging Het
Vwce T C 19: 10,638,127 V124A probably benign Het
Wdr60 C T 12: 116,241,712 R419H probably damaging Het
Zc3h15 G A 2: 83,661,443 R292H probably benign Het
Other mutations in Impg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Impg2 APN 16 56261605 nonsense probably null
IGL01097:Impg2 APN 16 56260647 critical splice donor site probably null
IGL01115:Impg2 APN 16 56259440 missense possibly damaging 0.61
IGL01545:Impg2 APN 16 56225717 splice site probably benign
IGL01644:Impg2 APN 16 56259870 missense probably benign 0.04
IGL01690:Impg2 APN 16 56205205 missense probably damaging 0.97
IGL01781:Impg2 APN 16 56252225 missense probably benign 0.21
IGL01801:Impg2 APN 16 56236748 missense probably damaging 0.97
IGL01980:Impg2 APN 16 56221527 missense probably damaging 0.99
IGL02059:Impg2 APN 16 56259972 missense probably damaging 1.00
IGL02140:Impg2 APN 16 56259468 missense probably benign 0.05
IGL02206:Impg2 APN 16 56259597 missense possibly damaging 0.92
IGL02245:Impg2 APN 16 56269082 missense probably damaging 0.96
IGL02584:Impg2 APN 16 56265011 missense probably damaging 1.00
IGL03061:Impg2 APN 16 56268416 missense probably damaging 1.00
IGL03123:Impg2 APN 16 56267122 missense probably damaging 1.00
IGL03280:Impg2 APN 16 56268268 nonsense probably null
R0051:Impg2 UTSW 16 56258048 missense probably damaging 1.00
R0117:Impg2 UTSW 16 56261642 missense probably damaging 0.99
R0193:Impg2 UTSW 16 56265049 nonsense probably null
R0270:Impg2 UTSW 16 56269015 missense possibly damaging 0.88
R0326:Impg2 UTSW 16 56260485 missense probably damaging 1.00
R0330:Impg2 UTSW 16 56252264 missense probably damaging 0.99
R0812:Impg2 UTSW 16 56257939 intron probably benign
R1074:Impg2 UTSW 16 56265178 splice site probably benign
R1283:Impg2 UTSW 16 56257939 intron probably benign
R1618:Impg2 UTSW 16 56259858 missense probably damaging 0.97
R1708:Impg2 UTSW 16 56265078 missense probably benign 0.10
R1713:Impg2 UTSW 16 56260526 missense probably benign 0.25
R1827:Impg2 UTSW 16 56267220 missense possibly damaging 0.62
R1853:Impg2 UTSW 16 56260277 missense probably damaging 1.00
R2064:Impg2 UTSW 16 56243630 critical splice donor site probably null
R2100:Impg2 UTSW 16 56231385 splice site probably null
R2125:Impg2 UTSW 16 56265064 missense probably damaging 1.00
R2128:Impg2 UTSW 16 56218379 missense probably damaging 1.00
R2195:Impg2 UTSW 16 56260134 missense probably benign 0.39
R2247:Impg2 UTSW 16 56268264 missense probably damaging 0.97
R2366:Impg2 UTSW 16 56259873 missense probably benign 0.04
R2411:Impg2 UTSW 16 56252154 missense probably damaging 1.00
R4193:Impg2 UTSW 16 56268411 missense probably benign 0.00
R4356:Impg2 UTSW 16 56260164 missense probably damaging 1.00
R4424:Impg2 UTSW 16 56260025 missense possibly damaging 0.56
R4575:Impg2 UTSW 16 56261732 missense probably damaging 1.00
R4766:Impg2 UTSW 16 56257939 intron probably benign
R5024:Impg2 UTSW 16 56260100 missense probably damaging 0.97
R5278:Impg2 UTSW 16 56221517 missense probably benign 0.06
R5383:Impg2 UTSW 16 56243626 missense probably benign 0.03
R5766:Impg2 UTSW 16 56259820 missense possibly damaging 0.73
R5909:Impg2 UTSW 16 56258136 missense probably damaging 0.99
R6525:Impg2 UTSW 16 56205149 missense probably damaging 1.00
R6684:Impg2 UTSW 16 56259929 missense probably benign 0.33
R6692:Impg2 UTSW 16 56252333 missense probably damaging 1.00
R6711:Impg2 UTSW 16 56265086 missense probably damaging 1.00
R6909:Impg2 UTSW 16 56204584 missense probably damaging 0.97
R6959:Impg2 UTSW 16 56268330 missense probably benign 0.01
R7226:Impg2 UTSW 16 56267104 nonsense probably null
R7456:Impg2 UTSW 16 56259913 missense probably benign 0.03
R7528:Impg2 UTSW 16 56260380 missense possibly damaging 0.86
R7532:Impg2 UTSW 16 56267180 missense probably damaging 0.96
R7601:Impg2 UTSW 16 56260031 missense probably benign 0.22
R7803:Impg2 UTSW 16 56267150 missense probably damaging 0.99
R8063:Impg2 UTSW 16 56261456 intron probably benign
R8251:Impg2 UTSW 16 56259597 missense possibly damaging 0.92
R8292:Impg2 UTSW 16 56260626 missense probably damaging 1.00
R8481:Impg2 UTSW 16 56252266 missense possibly damaging 0.76
R8524:Impg2 UTSW 16 56218394 missense probably benign 0.03
R8795:Impg2 UTSW 16 56260248 missense probably benign 0.25
R8901:Impg2 UTSW 16 56252165 missense probably damaging 1.00
X0023:Impg2 UTSW 16 56259876 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCCATTGTTCCTGGTAACTG -3'
(R):5'- GTCTCACTCCATGGCCAATC -3'

Sequencing Primer
(F):5'- CTGGTAACTGGAGAAAATAGATAGC -3'
(R):5'- AAGTCTTTTTCCACAGAGGTGTC -3'
Posted On2021-04-30