Incidental Mutation 'R8783:Erbb4'
ID670369
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8783 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 68040172 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 1250 (Y1250D)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119142
AA Change: Y1266D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: Y1266D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121473
AA Change: Y1250D

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: Y1250D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik T A 13: 54,552,707 M273L probably benign Het
Aars A G 8: 111,049,883 N657S probably benign Het
Ahnak A T 19: 9,011,473 N3374Y probably damaging Het
Ank2 T C 3: 127,052,806 E180G probably damaging Het
Armc5 G A 7: 128,238,253 A43T probably damaging Het
Atad3a T A 4: 155,755,695 D142V probably damaging Het
B4galnt4 A T 7: 141,063,846 K54M probably damaging Het
Bcl11b T C 12: 107,917,303 E251G probably damaging Het
Bptf A G 11: 107,131,531 V131A unknown Het
Btbd7 T A 12: 102,788,242 H755L probably benign Het
Cadps2 A G 6: 23,302,304 V1128A possibly damaging Het
Ccl2 T C 11: 82,036,534 I43T probably damaging Het
Cdc25b T G 2: 131,191,852 S207A probably benign Het
Chd4 A G 6: 125,123,384 T1725A possibly damaging Het
Cmya5 A T 13: 93,089,380 S3067T possibly damaging Het
Col9a3 G A 2: 180,614,177 D448N probably damaging Het
Cpxm1 C A 2: 130,395,723 R187S probably benign Het
Cramp1l T A 17: 24,974,758 N916I probably damaging Het
Creld1 A G 6: 113,491,725 Y269C probably damaging Het
Ctsz G T 2: 174,438,882 S6* probably null Het
Cul7 T C 17: 46,655,649 S633P probably benign Het
Eci2 T A 13: 34,990,197 N160I probably damaging Het
Eef2 T A 10: 81,179,665 M340K probably damaging Het
Enpp6 A T 8: 46,987,185 Y72F possibly damaging Het
Fhad1 C T 4: 141,909,092 V1146M probably benign Het
Fryl T C 5: 73,068,842 Y1826C probably benign Het
Gm3252 A G 14: 4,743,761 K200E probably benign Het
Gm4858 A G 3: 93,074,473 Y192C probably damaging Het
Gm9573 T C 17: 35,619,983 T1104A unknown Het
Gramd1a T C 7: 31,132,795 T640A possibly damaging Het
Gse1 A T 8: 120,576,378 Q1086L unknown Het
Gtf2f2 C A 14: 76,007,724 G41W probably damaging Het
Hhat A G 1: 192,513,937 Y483H probably damaging Het
Ifna13 T A 4: 88,644,289 R33W probably damaging Het
Ighg2c T A 12: 113,288,792 S47C Het
Ing5 A T 1: 93,812,432 D101V probably damaging Het
Kif23 T C 9: 61,927,571 T379A probably benign Het
Ltn1 A T 16: 87,410,359 S898T probably benign Het
Mep1a T C 17: 43,478,190 D578G probably benign Het
Mgam A T 6: 40,656,489 H243L probably damaging Het
Mlf1 G A 3: 67,384,664 R54H probably benign Het
Mtus2 A T 5: 148,083,051 K752M probably damaging Het
Mup18 T A 4: 61,673,530 D53V probably benign Het
Neb A T 2: 52,258,632 D2634E probably damaging Het
Nfatc3 A T 8: 106,099,152 I620F possibly damaging Het
Nrg1 A T 8: 31,958,601 L104Q probably benign Het
Nsd2 T A 5: 33,879,111 D646E possibly damaging Het
Olfr1180 T C 2: 88,412,607 N17S probably benign Het
Olfr1490 A T 19: 13,654,959 R177W probably damaging Het
Olfr632 A T 7: 103,937,544 T55S possibly damaging Het
Pbp2 T C 6: 135,310,332 S6G probably benign Het
Pcdhga5 T C 18: 37,695,543 I348T probably benign Het
Pdxk A G 10: 78,451,505 V74A probably benign Het
Pdzrn3 C T 6: 101,155,880 R469H probably damaging Het
Pla2g4a A T 1: 149,864,990 S395R probably damaging Het
Polr2i A G 7: 30,232,365 Y7C possibly damaging Het
Psmc5 A T 11: 106,263,032 K397N possibly damaging Het
Ptprz1 A G 6: 23,002,027 D1372G probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rapgef2 A T 3: 79,098,344 V181E probably damaging Het
Rassf3 T G 10: 121,417,164 N46T probably benign Het
Rnf123 T C 9: 108,069,073 E301G probably benign Het
Sec24b T A 3: 129,989,693 M1099L probably benign Het
Shisa4 A G 1: 135,373,206 C109R probably damaging Het
Slc7a1 T A 5: 148,342,833 E237V probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r105 A G 6: 131,686,769 I232T possibly damaging Het
Tas2r136 T C 6: 132,777,649 T172A probably benign Het
Trim6 G A 7: 104,225,646 C30Y probably damaging Het
Trim65 T A 11: 116,126,317 N440Y probably damaging Het
Ttn A C 2: 76,743,350 I25733S probably damaging Het
Ttn T G 2: 76,789,014 T16035P probably damaging Het
Vmn2r73 A T 7: 85,858,460 M548K probably damaging Het
Vmn2r88 A T 14: 51,414,066 E279V Het
Wfdc8 G A 2: 164,605,849 S97F probably benign Het
Wrn G A 8: 33,336,013 A207V probably null Het
Xrcc2 T C 5: 25,692,219 D244G possibly damaging Het
Zfp251 C T 15: 76,853,213 G560E probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAAACTACTGGCCTTGGGAG -3'
(R):5'- ACACCTTCGCCAATGCCTTG -3'

Sequencing Primer
(F):5'- CTACTGGCCTTGGGAGAAGAAG -3'
(R):5'- CCTTGGGGAGTGCAGAGTAC -3'
Posted On2021-04-30