Incidental Mutation 'R8783:Fhad1'
ID670390
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8783 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141909092 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1146 (V1146M)
Ref Sequence ENSEMBL: ENSMUSP00000101405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably benign
Transcript: ENSMUST00000105779
AA Change: V1146M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: V1146M

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105780
AA Change: V1146M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: V1146M

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik T A 13: 54,552,707 M273L probably benign Het
Aars A G 8: 111,049,883 N657S probably benign Het
Ahnak A T 19: 9,011,473 N3374Y probably damaging Het
Ank2 T C 3: 127,052,806 E180G probably damaging Het
Armc5 G A 7: 128,238,253 A43T probably damaging Het
Atad3a T A 4: 155,755,695 D142V probably damaging Het
B4galnt4 A T 7: 141,063,846 K54M probably damaging Het
Bcl11b T C 12: 107,917,303 E251G probably damaging Het
Bptf A G 11: 107,131,531 V131A unknown Het
Btbd7 T A 12: 102,788,242 H755L probably benign Het
Cadps2 A G 6: 23,302,304 V1128A possibly damaging Het
Ccl2 T C 11: 82,036,534 I43T probably damaging Het
Cdc25b T G 2: 131,191,852 S207A probably benign Het
Chd4 A G 6: 125,123,384 T1725A possibly damaging Het
Cmya5 A T 13: 93,089,380 S3067T possibly damaging Het
Col9a3 G A 2: 180,614,177 D448N probably damaging Het
Cpxm1 C A 2: 130,395,723 R187S probably benign Het
Cramp1l T A 17: 24,974,758 N916I probably damaging Het
Creld1 A G 6: 113,491,725 Y269C probably damaging Het
Ctsz G T 2: 174,438,882 S6* probably null Het
Cul7 T C 17: 46,655,649 S633P probably benign Het
Eci2 T A 13: 34,990,197 N160I probably damaging Het
Eef2 T A 10: 81,179,665 M340K probably damaging Het
Enpp6 A T 8: 46,987,185 Y72F possibly damaging Het
Erbb4 A C 1: 68,040,172 Y1250D possibly damaging Het
Fryl T C 5: 73,068,842 Y1826C probably benign Het
Gm3252 A G 14: 4,743,761 K200E probably benign Het
Gm4858 A G 3: 93,074,473 Y192C probably damaging Het
Gm9573 T C 17: 35,619,983 T1104A unknown Het
Gramd1a T C 7: 31,132,795 T640A possibly damaging Het
Gse1 A T 8: 120,576,378 Q1086L unknown Het
Gtf2f2 C A 14: 76,007,724 G41W probably damaging Het
Hhat A G 1: 192,513,937 Y483H probably damaging Het
Ifna13 T A 4: 88,644,289 R33W probably damaging Het
Ighg2c T A 12: 113,288,792 S47C Het
Ing5 A T 1: 93,812,432 D101V probably damaging Het
Kif23 T C 9: 61,927,571 T379A probably benign Het
Ltn1 A T 16: 87,410,359 S898T probably benign Het
Mep1a T C 17: 43,478,190 D578G probably benign Het
Mgam A T 6: 40,656,489 H243L probably damaging Het
Mlf1 G A 3: 67,384,664 R54H probably benign Het
Mtus2 A T 5: 148,083,051 K752M probably damaging Het
Mup18 T A 4: 61,673,530 D53V probably benign Het
Neb A T 2: 52,258,632 D2634E probably damaging Het
Nfatc3 A T 8: 106,099,152 I620F possibly damaging Het
Nrg1 A T 8: 31,958,601 L104Q probably benign Het
Nsd2 T A 5: 33,879,111 D646E possibly damaging Het
Olfr1180 T C 2: 88,412,607 N17S probably benign Het
Olfr1490 A T 19: 13,654,959 R177W probably damaging Het
Olfr632 A T 7: 103,937,544 T55S possibly damaging Het
Pbp2 T C 6: 135,310,332 S6G probably benign Het
Pcdhga5 T C 18: 37,695,543 I348T probably benign Het
Pdxk A G 10: 78,451,505 V74A probably benign Het
Pdzrn3 C T 6: 101,155,880 R469H probably damaging Het
Pla2g4a A T 1: 149,864,990 S395R probably damaging Het
Polr2i A G 7: 30,232,365 Y7C possibly damaging Het
Psmc5 A T 11: 106,263,032 K397N possibly damaging Het
Ptprz1 A G 6: 23,002,027 D1372G probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rapgef2 A T 3: 79,098,344 V181E probably damaging Het
Rassf3 T G 10: 121,417,164 N46T probably benign Het
Rnf123 T C 9: 108,069,073 E301G probably benign Het
Sec24b T A 3: 129,989,693 M1099L probably benign Het
Shisa4 A G 1: 135,373,206 C109R probably damaging Het
Slc7a1 T A 5: 148,342,833 E237V probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r105 A G 6: 131,686,769 I232T possibly damaging Het
Tas2r136 T C 6: 132,777,649 T172A probably benign Het
Trim6 G A 7: 104,225,646 C30Y probably damaging Het
Trim65 T A 11: 116,126,317 N440Y probably damaging Het
Ttn A C 2: 76,743,350 I25733S probably damaging Het
Ttn T G 2: 76,789,014 T16035P probably damaging Het
Vmn2r73 A T 7: 85,858,460 M548K probably damaging Het
Vmn2r88 A T 14: 51,414,066 E279V Het
Wfdc8 G A 2: 164,605,849 S97F probably benign Het
Wrn G A 8: 33,336,013 A207V probably null Het
Xrcc2 T C 5: 25,692,219 D244G possibly damaging Het
Zfp251 C T 15: 76,853,213 G560E probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACACTGTCTTGAGGCTCAG -3'
(R):5'- CTGCAATGATGGCCAAAGC -3'

Sequencing Primer
(F):5'- ACTGTCTTGAGGCTCAGCTGAC -3'
(R):5'- ACTCACTGTGTGGCCTCG -3'
Posted On2021-04-30