Incidental Mutation 'R8783:Cadps2'
ID670399
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene NameCa2+-dependent activator protein for secretion 2
SynonymsCaps2, cpd2, A230044C21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8783 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location23262773-23839421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23302304 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1128 (V1128A)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000018122
AA Change: V1173A

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: V1173A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: V1166A

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: V1166A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115358
AA Change: V1133A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: V1133A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115361
AA Change: V1128A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: V1128A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125350
AA Change: V768A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: V768A

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142913
AA Change: V1144A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: V1144A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163871
AA Change: V1173A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: V1173A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166458
AA Change: V1144A

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: V1144A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik T A 13: 54,552,707 M273L probably benign Het
Aars A G 8: 111,049,883 N657S probably benign Het
Ahnak A T 19: 9,011,473 N3374Y probably damaging Het
Ank2 T C 3: 127,052,806 E180G probably damaging Het
Armc5 G A 7: 128,238,253 A43T probably damaging Het
Atad3a T A 4: 155,755,695 D142V probably damaging Het
B4galnt4 A T 7: 141,063,846 K54M probably damaging Het
Bcl11b T C 12: 107,917,303 E251G probably damaging Het
Bptf A G 11: 107,131,531 V131A unknown Het
Btbd7 T A 12: 102,788,242 H755L probably benign Het
Ccl2 T C 11: 82,036,534 I43T probably damaging Het
Cdc25b T G 2: 131,191,852 S207A probably benign Het
Chd4 A G 6: 125,123,384 T1725A possibly damaging Het
Cmya5 A T 13: 93,089,380 S3067T possibly damaging Het
Col9a3 G A 2: 180,614,177 D448N probably damaging Het
Cpxm1 C A 2: 130,395,723 R187S probably benign Het
Cramp1l T A 17: 24,974,758 N916I probably damaging Het
Creld1 A G 6: 113,491,725 Y269C probably damaging Het
Ctsz G T 2: 174,438,882 S6* probably null Het
Cul7 T C 17: 46,655,649 S633P probably benign Het
Eci2 T A 13: 34,990,197 N160I probably damaging Het
Eef2 T A 10: 81,179,665 M340K probably damaging Het
Enpp6 A T 8: 46,987,185 Y72F possibly damaging Het
Erbb4 A C 1: 68,040,172 Y1250D possibly damaging Het
Fhad1 C T 4: 141,909,092 V1146M probably benign Het
Fryl T C 5: 73,068,842 Y1826C probably benign Het
Gm3252 A G 14: 4,743,761 K200E probably benign Het
Gm4858 A G 3: 93,074,473 Y192C probably damaging Het
Gm9573 T C 17: 35,619,983 T1104A unknown Het
Gramd1a T C 7: 31,132,795 T640A possibly damaging Het
Gse1 A T 8: 120,576,378 Q1086L unknown Het
Gtf2f2 C A 14: 76,007,724 G41W probably damaging Het
Hhat A G 1: 192,513,937 Y483H probably damaging Het
Ifna13 T A 4: 88,644,289 R33W probably damaging Het
Ighg2c T A 12: 113,288,792 S47C Het
Ing5 A T 1: 93,812,432 D101V probably damaging Het
Kif23 T C 9: 61,927,571 T379A probably benign Het
Ltn1 A T 16: 87,410,359 S898T probably benign Het
Mep1a T C 17: 43,478,190 D578G probably benign Het
Mgam A T 6: 40,656,489 H243L probably damaging Het
Mlf1 G A 3: 67,384,664 R54H probably benign Het
Mtus2 A T 5: 148,083,051 K752M probably damaging Het
Mup18 T A 4: 61,673,530 D53V probably benign Het
Neb A T 2: 52,258,632 D2634E probably damaging Het
Nfatc3 A T 8: 106,099,152 I620F possibly damaging Het
Nrg1 A T 8: 31,958,601 L104Q probably benign Het
Nsd2 T A 5: 33,879,111 D646E possibly damaging Het
Olfr1180 T C 2: 88,412,607 N17S probably benign Het
Olfr1490 A T 19: 13,654,959 R177W probably damaging Het
Olfr632 A T 7: 103,937,544 T55S possibly damaging Het
Pbp2 T C 6: 135,310,332 S6G probably benign Het
Pcdhga5 T C 18: 37,695,543 I348T probably benign Het
Pdxk A G 10: 78,451,505 V74A probably benign Het
Pdzrn3 C T 6: 101,155,880 R469H probably damaging Het
Pla2g4a A T 1: 149,864,990 S395R probably damaging Het
Polr2i A G 7: 30,232,365 Y7C possibly damaging Het
Psmc5 A T 11: 106,263,032 K397N possibly damaging Het
Ptprz1 A G 6: 23,002,027 D1372G probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rapgef2 A T 3: 79,098,344 V181E probably damaging Het
Rassf3 T G 10: 121,417,164 N46T probably benign Het
Rnf123 T C 9: 108,069,073 E301G probably benign Het
Sec24b T A 3: 129,989,693 M1099L probably benign Het
Shisa4 A G 1: 135,373,206 C109R probably damaging Het
Slc7a1 T A 5: 148,342,833 E237V probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r105 A G 6: 131,686,769 I232T possibly damaging Het
Tas2r136 T C 6: 132,777,649 T172A probably benign Het
Trim6 G A 7: 104,225,646 C30Y probably damaging Het
Trim65 T A 11: 116,126,317 N440Y probably damaging Het
Ttn A C 2: 76,743,350 I25733S probably damaging Het
Ttn T G 2: 76,789,014 T16035P probably damaging Het
Vmn2r73 A T 7: 85,858,460 M548K probably damaging Het
Vmn2r88 A T 14: 51,414,066 E279V Het
Wfdc8 G A 2: 164,605,849 S97F probably benign Het
Wrn G A 8: 33,336,013 A207V probably null Het
Xrcc2 T C 5: 25,692,219 D244G possibly damaging Het
Zfp251 C T 15: 76,853,213 G560E probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTTAGAGAACTGAAGACAACTG -3'
(R):5'- TCGAGGTATGACGAAGGCAC -3'

Sequencing Primer
(F):5'- CCAATTCATAATTATGAGGGGCTCGG -3'
(R):5'- AGGCACTTTCTTCTCATCCATCCTG -3'
Posted On2021-04-30