Incidental Mutation 'R8783:Vmn2r73'
ID 670409
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Name vomeronasal 2, receptor 73
Synonyms EG620928
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R8783 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 85857547-85875938 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85858460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 548 (M548K)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
AlphaFold D3Z7M3
Predicted Effect probably damaging
Transcript: ENSMUST00000077478
AA Change: M548K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: M548K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik T A 13: 54,552,707 M273L probably benign Het
Aars A G 8: 111,049,883 N657S probably benign Het
Ahnak A T 19: 9,011,473 N3374Y probably damaging Het
Ank2 T C 3: 127,052,806 E180G probably damaging Het
Arhgap20 T A 9: 51,816,667 probably benign Het
Armc5 G A 7: 128,238,253 A43T probably damaging Het
Atad3a T A 4: 155,755,695 D142V probably damaging Het
B4galnt4 A T 7: 141,063,846 K54M probably damaging Het
Bcl11b T C 12: 107,917,303 E251G probably damaging Het
Bptf A G 11: 107,131,531 V131A unknown Het
Btbd7 T A 12: 102,788,242 H755L probably benign Het
Cadps2 A G 6: 23,302,304 V1128A possibly damaging Het
Ccl2 T C 11: 82,036,534 I43T probably damaging Het
Cdc25b T G 2: 131,191,852 S207A probably benign Het
Chd4 A G 6: 125,123,384 T1725A possibly damaging Het
Cmya5 A T 13: 93,089,380 S3067T possibly damaging Het
Col9a3 G A 2: 180,614,177 D448N probably damaging Het
Cpxm1 C A 2: 130,395,723 R187S probably benign Het
Cramp1l T A 17: 24,974,758 N916I probably damaging Het
Creld1 A G 6: 113,491,725 Y269C probably damaging Het
Ctsz G T 2: 174,438,882 S6* probably null Het
Cul7 T C 17: 46,655,649 S633P probably benign Het
Eci2 T A 13: 34,990,197 N160I probably damaging Het
Eef2 T A 10: 81,179,665 M340K probably damaging Het
Enpp6 A T 8: 46,987,185 Y72F possibly damaging Het
Erbb4 A C 1: 68,040,172 Y1250D possibly damaging Het
Fhad1 C T 4: 141,909,092 V1146M probably benign Het
Fryl T C 5: 73,068,842 Y1826C probably benign Het
Gm3252 A G 14: 4,743,761 K200E probably benign Het
Gm4858 A G 3: 93,074,473 Y192C probably damaging Het
Gm9573 T C 17: 35,619,983 T1104A unknown Het
Gramd1a T C 7: 31,132,795 T640A possibly damaging Het
Gse1 A T 8: 120,576,378 Q1086L unknown Het
Gtf2f2 C A 14: 76,007,724 G41W probably damaging Het
Hhat A G 1: 192,513,937 Y483H probably damaging Het
Ifna13 T A 4: 88,644,289 R33W probably damaging Het
Ighg2c T A 12: 113,288,792 S47C Het
Ing5 A T 1: 93,812,432 D101V probably damaging Het
Kif23 T C 9: 61,927,571 T379A probably benign Het
Ltn1 A T 16: 87,410,359 S898T probably benign Het
Mep1a T C 17: 43,478,190 D578G probably benign Het
Mgam A T 6: 40,656,489 H243L probably damaging Het
Mlf1 G A 3: 67,384,664 R54H probably benign Het
Mtus2 A T 5: 148,083,051 K752M probably damaging Het
Mup18 T A 4: 61,673,530 D53V probably benign Het
Neb A T 2: 52,258,632 D2634E probably damaging Het
Nfatc3 A T 8: 106,099,152 I620F possibly damaging Het
Nrg1 A T 8: 31,958,601 L104Q probably benign Het
Nsd2 T A 5: 33,879,111 D646E possibly damaging Het
Olfr1180 T C 2: 88,412,607 N17S probably benign Het
Olfr1490 A T 19: 13,654,959 R177W probably damaging Het
Olfr632 A T 7: 103,937,544 T55S possibly damaging Het
Pbp2 T C 6: 135,310,332 S6G probably benign Het
Pcdhga5 T C 18: 37,695,543 I348T probably benign Het
Pdxk A G 10: 78,451,505 V74A probably benign Het
Pdzrn3 C T 6: 101,155,880 R469H probably damaging Het
Pla2g4a A T 1: 149,864,990 S395R probably damaging Het
Polr2i A G 7: 30,232,365 Y7C possibly damaging Het
Psmc5 A T 11: 106,263,032 K397N possibly damaging Het
Ptprz1 A G 6: 23,002,027 D1372G probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rapgef2 A T 3: 79,098,344 V181E probably damaging Het
Rassf3 T G 10: 121,417,164 N46T probably benign Het
Rnf123 T C 9: 108,069,073 E301G probably benign Het
Sec24b T A 3: 129,989,693 M1099L probably benign Het
Shisa4 A G 1: 135,373,206 C109R probably damaging Het
Slc7a1 T A 5: 148,342,833 E237V probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r105 A G 6: 131,686,769 I232T possibly damaging Het
Tas2r136 T C 6: 132,777,649 T172A probably benign Het
Trim6 G A 7: 104,225,646 C30Y probably damaging Het
Trim65 T A 11: 116,126,317 N440Y probably damaging Het
Ttn A C 2: 76,743,350 I25733S probably damaging Het
Ttn T G 2: 76,789,014 T16035P probably damaging Het
Vmn2r88 A T 14: 51,414,066 E279V Het
Wfdc8 G A 2: 164,605,849 S97F probably benign Het
Wrn G A 8: 33,336,013 A207V probably null Het
Xrcc2 T C 5: 25,692,219 D244G possibly damaging Het
Zfp251 C T 15: 76,853,213 G560E probably damaging Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
G1Funyon:Vmn2r73 UTSW 7 85858302 missense probably benign 0.00
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
R7650:Vmn2r73 UTSW 7 85871939 missense probably benign
R7811:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R8263:Vmn2r73 UTSW 7 85858411 missense probably benign
R8301:Vmn2r73 UTSW 7 85858302 missense probably benign 0.00
R8341:Vmn2r73 UTSW 7 85857920 missense probably benign 0.01
R8500:Vmn2r73 UTSW 7 85870430 missense probably benign 0.01
R8673:Vmn2r73 UTSW 7 85872694 missense probably benign 0.01
R8719:Vmn2r73 UTSW 7 85871887 missense probably damaging 0.96
R8828:Vmn2r73 UTSW 7 85871971 missense probably damaging 0.98
R8860:Vmn2r73 UTSW 7 85872941 splice site probably benign
R9002:Vmn2r73 UTSW 7 85858076 missense probably benign 0.32
R9008:Vmn2r73 UTSW 7 85872696 missense probably damaging 0.96
R9159:Vmn2r73 UTSW 7 85872723 missense possibly damaging 0.90
R9180:Vmn2r73 UTSW 7 85857915 missense probably benign 0.07
R9198:Vmn2r73 UTSW 7 85869779 missense probably benign 0.01
R9329:Vmn2r73 UTSW 7 85869865 missense probably benign
R9448:Vmn2r73 UTSW 7 85872819 missense probably benign 0.00
R9463:Vmn2r73 UTSW 7 85857587 missense
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Z1176:Vmn2r73 UTSW 7 85871968 missense probably damaging 0.99
Z1177:Vmn2r73 UTSW 7 85872272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAGGAAGATGCAAAGAACACC -3'
(R):5'- CAAGCTAAGATATGTGACTGTGGAAAC -3'

Sequencing Primer
(F):5'- TGCAAAGAACACCAGATGTAATAAC -3'
(R):5'- ATGCTATGGAGCTTGCAC -3'
Posted On 2021-04-30