Incidental Mutation 'R8783:Rnf123'
ID 670421
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 068631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R8783 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107946272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 301 (E301G)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: E301G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: E301G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: E301G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: E301G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: E301G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: E301G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: E301G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: E301G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: E301G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: E301G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik T A 13: 54,700,520 (GRCm39) M273L probably benign Het
Aars1 A G 8: 111,776,515 (GRCm39) N657S probably benign Het
Ahnak A T 19: 8,988,837 (GRCm39) N3374Y probably damaging Het
Ank2 T C 3: 126,846,455 (GRCm39) E180G probably damaging Het
Arhgap20 T A 9: 51,727,967 (GRCm39) probably benign Het
Armc5 G A 7: 127,837,425 (GRCm39) A43T probably damaging Het
Atad3a T A 4: 155,840,152 (GRCm39) D142V probably damaging Het
B4galnt4 A T 7: 140,643,759 (GRCm39) K54M probably damaging Het
Bcl11b T C 12: 107,883,562 (GRCm39) E251G probably damaging Het
Bptf A G 11: 107,022,357 (GRCm39) V131A unknown Het
Btbd7 T A 12: 102,754,501 (GRCm39) H755L probably benign Het
Cadps2 A G 6: 23,302,303 (GRCm39) V1128A possibly damaging Het
Ccl2 T C 11: 81,927,360 (GRCm39) I43T probably damaging Het
Cdc25b T G 2: 131,033,772 (GRCm39) S207A probably benign Het
Chd4 A G 6: 125,100,347 (GRCm39) T1725A possibly damaging Het
Cmya5 A T 13: 93,225,888 (GRCm39) S3067T possibly damaging Het
Col9a3 G A 2: 180,255,970 (GRCm39) D448N probably damaging Het
Cpxm1 C A 2: 130,237,643 (GRCm39) R187S probably benign Het
Cramp1 T A 17: 25,193,732 (GRCm39) N916I probably damaging Het
Creld1 A G 6: 113,468,686 (GRCm39) Y269C probably damaging Het
Ctsz G T 2: 174,280,675 (GRCm39) S6* probably null Het
Cul7 T C 17: 46,966,575 (GRCm39) S633P probably benign Het
Eci2 T A 13: 35,174,180 (GRCm39) N160I probably damaging Het
Eef2 T A 10: 81,015,499 (GRCm39) M340K probably damaging Het
Enpp6 A T 8: 47,440,220 (GRCm39) Y72F possibly damaging Het
Erbb4 A C 1: 68,079,331 (GRCm39) Y1250D possibly damaging Het
Fhad1 C T 4: 141,636,403 (GRCm39) V1146M probably benign Het
Fryl T C 5: 73,226,185 (GRCm39) Y1826C probably benign Het
Gm3252 A G 14: 4,743,761 (GRCm38) K200E probably benign Het
Gramd1a T C 7: 30,832,220 (GRCm39) T640A possibly damaging Het
Gse1 A T 8: 121,303,117 (GRCm39) Q1086L unknown Het
Gtf2f2 C A 14: 76,245,164 (GRCm39) G41W probably damaging Het
Hhat A G 1: 192,196,245 (GRCm39) Y483H probably damaging Het
Ifna13 T A 4: 88,562,526 (GRCm39) R33W probably damaging Het
Ighg2c T A 12: 113,252,412 (GRCm39) S47C Het
Ing5 A T 1: 93,740,154 (GRCm39) D101V probably damaging Het
Kif23 T C 9: 61,834,853 (GRCm39) T379A probably benign Het
Ltn1 A T 16: 87,207,247 (GRCm39) S898T probably benign Het
Mep1a T C 17: 43,789,081 (GRCm39) D578G probably benign Het
Mgam A T 6: 40,633,423 (GRCm39) H243L probably damaging Het
Mlf1 G A 3: 67,291,997 (GRCm39) R54H probably benign Het
Mtus2 A T 5: 148,019,861 (GRCm39) K752M probably damaging Het
Muc21 T C 17: 35,930,875 (GRCm39) T1104A unknown Het
Mup18 T A 4: 61,591,767 (GRCm39) D53V probably benign Het
Neb A T 2: 52,148,644 (GRCm39) D2634E probably damaging Het
Nfatc3 A T 8: 106,825,784 (GRCm39) I620F possibly damaging Het
Nrg1 A T 8: 32,448,629 (GRCm39) L104Q probably benign Het
Nsd2 T A 5: 34,036,455 (GRCm39) D646E possibly damaging Het
Or10w1 A T 19: 13,632,323 (GRCm39) R177W probably damaging Het
Or4p19 T C 2: 88,242,951 (GRCm39) N17S probably benign Het
Or51ai2 A T 7: 103,586,751 (GRCm39) T55S possibly damaging Het
Pbp2 T C 6: 135,287,330 (GRCm39) S6G probably benign Het
Pcdhga5 T C 18: 37,828,596 (GRCm39) I348T probably benign Het
Pdxk A G 10: 78,287,339 (GRCm39) V74A probably benign Het
Pdzrn3 C T 6: 101,132,841 (GRCm39) R469H probably damaging Het
Pla2g4a A T 1: 149,740,741 (GRCm39) S395R probably damaging Het
Polr2i A G 7: 29,931,790 (GRCm39) Y7C possibly damaging Het
Psmc5 A T 11: 106,153,858 (GRCm39) K397N possibly damaging Het
Ptprz1 A G 6: 23,002,026 (GRCm39) D1372G probably benign Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rapgef2 A T 3: 79,005,651 (GRCm39) V181E probably damaging Het
Rassf3 T G 10: 121,253,069 (GRCm39) N46T probably benign Het
Sec24b T A 3: 129,783,342 (GRCm39) M1099L probably benign Het
Shisa4 A G 1: 135,300,944 (GRCm39) C109R probably damaging Het
Slc7a1 T A 5: 148,279,643 (GRCm39) E237V probably benign Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Tas2r105 A G 6: 131,663,732 (GRCm39) I232T possibly damaging Het
Tas2r136 T C 6: 132,754,612 (GRCm39) T172A probably benign Het
Tdpoz8 A G 3: 92,981,780 (GRCm39) Y192C probably damaging Het
Trim6 G A 7: 103,874,853 (GRCm39) C30Y probably damaging Het
Trim65 T A 11: 116,017,143 (GRCm39) N440Y probably damaging Het
Ttn A C 2: 76,573,694 (GRCm39) I25733S probably damaging Het
Ttn T G 2: 76,619,358 (GRCm39) T16035P probably damaging Het
Vmn2r73 A T 7: 85,507,668 (GRCm39) M548K probably damaging Het
Vmn2r88 A T 14: 51,651,523 (GRCm39) E279V Het
Wfdc8 G A 2: 164,447,769 (GRCm39) S97F probably benign Het
Wrn G A 8: 33,826,041 (GRCm39) A207V probably null Het
Xrcc2 T C 5: 25,897,217 (GRCm39) D244G possibly damaging Het
Zfp251 C T 15: 76,737,413 (GRCm39) G560E probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTAACACGCTTAGCACCC -3'
(R):5'- TAACTCAGTGGCACCTACCC -3'

Sequencing Primer
(F):5'- ACGCTTAGCACCCGAGGC -3'
(R):5'- TCAGTGGCACCTACCCAGTTG -3'
Posted On 2021-04-30