Incidental Mutation 'R8783:Cmya5'
ID 670435
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock # R8783 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 93040713-93144724 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93089380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 3067 (S3067T)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000062122
AA Change: S3067T

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: S3067T

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik T A 13: 54,552,707 M273L probably benign Het
Aars A G 8: 111,049,883 N657S probably benign Het
Ahnak A T 19: 9,011,473 N3374Y probably damaging Het
Ank2 T C 3: 127,052,806 E180G probably damaging Het
Arhgap20 T A 9: 51,816,667 probably benign Het
Armc5 G A 7: 128,238,253 A43T probably damaging Het
Atad3a T A 4: 155,755,695 D142V probably damaging Het
B4galnt4 A T 7: 141,063,846 K54M probably damaging Het
Bcl11b T C 12: 107,917,303 E251G probably damaging Het
Bptf A G 11: 107,131,531 V131A unknown Het
Btbd7 T A 12: 102,788,242 H755L probably benign Het
Cadps2 A G 6: 23,302,304 V1128A possibly damaging Het
Ccl2 T C 11: 82,036,534 I43T probably damaging Het
Cdc25b T G 2: 131,191,852 S207A probably benign Het
Chd4 A G 6: 125,123,384 T1725A possibly damaging Het
Col9a3 G A 2: 180,614,177 D448N probably damaging Het
Cpxm1 C A 2: 130,395,723 R187S probably benign Het
Cramp1l T A 17: 24,974,758 N916I probably damaging Het
Creld1 A G 6: 113,491,725 Y269C probably damaging Het
Ctsz G T 2: 174,438,882 S6* probably null Het
Cul7 T C 17: 46,655,649 S633P probably benign Het
Eci2 T A 13: 34,990,197 N160I probably damaging Het
Eef2 T A 10: 81,179,665 M340K probably damaging Het
Enpp6 A T 8: 46,987,185 Y72F possibly damaging Het
Erbb4 A C 1: 68,040,172 Y1250D possibly damaging Het
Fhad1 C T 4: 141,909,092 V1146M probably benign Het
Fryl T C 5: 73,068,842 Y1826C probably benign Het
Gm3252 A G 14: 4,743,761 K200E probably benign Het
Gm4858 A G 3: 93,074,473 Y192C probably damaging Het
Gm9573 T C 17: 35,619,983 T1104A unknown Het
Gramd1a T C 7: 31,132,795 T640A possibly damaging Het
Gse1 A T 8: 120,576,378 Q1086L unknown Het
Gtf2f2 C A 14: 76,007,724 G41W probably damaging Het
Hhat A G 1: 192,513,937 Y483H probably damaging Het
Ifna13 T A 4: 88,644,289 R33W probably damaging Het
Ighg2c T A 12: 113,288,792 S47C Het
Ing5 A T 1: 93,812,432 D101V probably damaging Het
Kif23 T C 9: 61,927,571 T379A probably benign Het
Ltn1 A T 16: 87,410,359 S898T probably benign Het
Mep1a T C 17: 43,478,190 D578G probably benign Het
Mgam A T 6: 40,656,489 H243L probably damaging Het
Mlf1 G A 3: 67,384,664 R54H probably benign Het
Mtus2 A T 5: 148,083,051 K752M probably damaging Het
Mup18 T A 4: 61,673,530 D53V probably benign Het
Neb A T 2: 52,258,632 D2634E probably damaging Het
Nfatc3 A T 8: 106,099,152 I620F possibly damaging Het
Nrg1 A T 8: 31,958,601 L104Q probably benign Het
Nsd2 T A 5: 33,879,111 D646E possibly damaging Het
Olfr1180 T C 2: 88,412,607 N17S probably benign Het
Olfr1490 A T 19: 13,654,959 R177W probably damaging Het
Olfr632 A T 7: 103,937,544 T55S possibly damaging Het
Pbp2 T C 6: 135,310,332 S6G probably benign Het
Pcdhga5 T C 18: 37,695,543 I348T probably benign Het
Pdxk A G 10: 78,451,505 V74A probably benign Het
Pdzrn3 C T 6: 101,155,880 R469H probably damaging Het
Pla2g4a A T 1: 149,864,990 S395R probably damaging Het
Polr2i A G 7: 30,232,365 Y7C possibly damaging Het
Psmc5 A T 11: 106,263,032 K397N possibly damaging Het
Ptprz1 A G 6: 23,002,027 D1372G probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rapgef2 A T 3: 79,098,344 V181E probably damaging Het
Rassf3 T G 10: 121,417,164 N46T probably benign Het
Rnf123 T C 9: 108,069,073 E301G probably benign Het
Sec24b T A 3: 129,989,693 M1099L probably benign Het
Shisa4 A G 1: 135,373,206 C109R probably damaging Het
Slc7a1 T A 5: 148,342,833 E237V probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r105 A G 6: 131,686,769 I232T possibly damaging Het
Tas2r136 T C 6: 132,777,649 T172A probably benign Het
Trim6 G A 7: 104,225,646 C30Y probably damaging Het
Trim65 T A 11: 116,126,317 N440Y probably damaging Het
Ttn A C 2: 76,743,350 I25733S probably damaging Het
Ttn T G 2: 76,789,014 T16035P probably damaging Het
Vmn2r73 A T 7: 85,858,460 M548K probably damaging Het
Vmn2r88 A T 14: 51,414,066 E279V Het
Wfdc8 G A 2: 164,605,849 S97F probably benign Het
Wrn G A 8: 33,336,013 A207V probably null Het
Xrcc2 T C 5: 25,692,219 D244G possibly damaging Het
Zfp251 C T 15: 76,853,213 G560E probably damaging Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense probably benign 0.00
R7088:Cmya5 UTSW 13 93091864 missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93089940 missense probably benign 0.41
R7177:Cmya5 UTSW 13 93095328 missense probably benign 0.00
R7188:Cmya5 UTSW 13 93046038 missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93090430 missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93095700 missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93092797 missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93092553 missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93091661 missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93069323 missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93091838 missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93097434 missense probably benign 0.02
R7552:Cmya5 UTSW 13 93069312 missense probably benign 0.41
R7624:Cmya5 UTSW 13 93090357 missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93083212 missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93094121 missense probably benign 0.13
R7753:Cmya5 UTSW 13 93098172 missense probably benign 0.18
R7757:Cmya5 UTSW 13 93098272 missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93094262 missense probably benign 0.00
R7825:Cmya5 UTSW 13 93097628 missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93089757 missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93096357 missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93097004 small deletion probably benign
R8127:Cmya5 UTSW 13 93094614 missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93093478 missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93091634 nonsense probably null
R8446:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93093796 missense probably benign 0.00
R8686:Cmya5 UTSW 13 93095380 missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93089721 missense probably damaging 1.00
R8803:Cmya5 UTSW 13 93041483 missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93063540 missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93096332 missense probably benign 0.01
R8985:Cmya5 UTSW 13 93097156 missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93092064 missense probably benign 0.03
R9087:Cmya5 UTSW 13 93097203 missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93097600 missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93097370 missense unknown
R9209:Cmya5 UTSW 13 93090358 missense probably benign 0.45
R9222:Cmya5 UTSW 13 93094071 missense probably benign 0.00
R9229:Cmya5 UTSW 13 93095668 missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93093376 missense probably benign
R9385:Cmya5 UTSW 13 93094372 missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93089701 missense probably benign 0.22
R9452:Cmya5 UTSW 13 93095886 missense probably benign
RF020:Cmya5 UTSW 13 93069291 missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93096790 missense unknown
Z1177:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTGTCCATTTCAGAGACC -3'
(R):5'- TGCCACCTATGCTCCTGAAG -3'

Sequencing Primer
(F):5'- TCAGAGACCAGGCTTTTGC -3'
(R):5'- CCTATGCTCCTGAAGTATTGCAAGAG -3'
Posted On 2021-04-30