Incidental Mutation 'R8784:Slc16a14'
ID 670451
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms 1110004H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 84905898-84935134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84913063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 174 (T174A)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
AlphaFold Q8K1C7
Predicted Effect probably benign
Transcript: ENSMUST00000027422
AA Change: T174A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: T174A

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,002,601 M614K probably benign Het
Adamts7 G T 9: 90,193,865 V1217L probably null Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Atf7ip A G 6: 136,599,650 D1017G probably damaging Het
Atg2b A C 12: 105,639,241 D1488E probably damaging Het
Atxn2 A G 5: 121,795,028 T805A probably benign Het
Azi2 A T 9: 118,055,892 H223L probably benign Het
Banp T A 8: 122,001,113 S349T probably damaging Het
Bicra A T 7: 15,971,950 I1522N probably damaging Het
Brca2 A T 5: 150,548,661 R2342* probably null Het
C6 T C 15: 4,793,140 C623R probably damaging Het
Cc2d2a T C 5: 43,703,303 Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,912,386 C115Y probably benign Het
Chrm4 T A 2: 91,927,688 M147K probably benign Het
Cit A T 5: 115,846,383 K5* probably null Het
Ciz1 T A 2: 32,370,250 S231T probably benign Het
Crebrf A G 17: 26,742,546 I206V probably benign Het
Cyc1 T C 15: 76,343,663 S34P probably benign Het
Dnah5 A G 15: 28,387,951 I3185M probably benign Het
Dtnbp1 T C 13: 44,922,226 D347G unknown Het
Dzip3 A T 16: 48,931,265 V767E probably damaging Het
E330021D16Rik G A 6: 136,401,731 Q34* probably null Het
Fam57a T C 11: 76,208,115 F237S probably damaging Het
Gdf3 A T 6: 122,606,320 C363S probably damaging Het
Glb1l T C 1: 75,200,331 K487R probably damaging Het
Gm9747 T C 1: 82,234,281 V67A unknown Het
Hoxb2 A G 11: 96,351,910 T34A possibly damaging Het
Ifnk C T 4: 35,152,383 R104C probably damaging Het
Igfbp1 A T 11: 7,201,952 I252F probably damaging Het
Ighv1-74 T C 12: 115,802,860 T47A probably benign Het
Igkv4-62 A T 6: 69,399,962 W68R probably damaging Het
Il23r A G 6: 67,466,417 I234T probably damaging Het
Ints2 T A 11: 86,222,137 I852F probably damaging Het
Ints2 G A 11: 86,225,115 Q763* probably null Het
Jhy T G 9: 40,960,886 H109P probably benign Het
Katna1 T A 10: 7,738,815 V29D possibly damaging Het
Kcng4 T A 8: 119,626,231 E313D probably benign Het
Klf14 T A 6: 30,958,114 H195L probably damaging Het
Lama3 A G 18: 12,421,155 N472S probably benign Het
Layn A T 9: 51,059,481 V254E possibly damaging Het
Lrba A T 3: 86,375,928 S1850C probably damaging Het
Map1s A G 8: 70,906,265 I2V unknown Het
Map3k12 T A 15: 102,505,362 Q58L possibly damaging Het
Minpp1 T C 19: 32,513,996 V358A probably benign Het
Mymk C G 2: 27,071,935 K27N possibly damaging Het
Nek8 T C 11: 78,172,549 K130E probably damaging Het
Ngef T A 1: 87,477,571 S706C probably damaging Het
Nsun6 G A 2: 14,996,495 Q417* probably null Het
Ntsr2 G T 12: 16,656,851 Q293H probably damaging Het
Ocln T A 13: 100,539,542 I148F probably damaging Het
Olfr101 A G 17: 37,299,810 I204T probably benign Het
Olfr1180 A T 2: 88,411,747 Y304N probably benign Het
Olfr948 T A 9: 39,318,693 Q307L probably benign Het
Pank3 T G 11: 35,781,585 F272V probably damaging Het
Piezo1 A T 8: 122,496,589 probably benign Het
Plppr4 G A 3: 117,322,541 R556* probably null Het
Polr1a G T 6: 71,950,628 R821L probably benign Het
Ppp1r36 C T 12: 76,439,193 T375I probably benign Het
Ptprj T A 2: 90,460,512 I628F possibly damaging Het
Puf60 C A 15: 76,077,676 V29F unknown Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf1 A G 9: 107,557,842 S179G probably benign Het
Rbm6 A G 9: 107,788,138 S772P possibly damaging Het
Rnf103 T G 6: 71,509,998 S538A probably benign Het
Scoc C A 8: 83,437,616 V58L probably benign Het
Secisbp2l G A 2: 125,760,343 Q366* probably null Het
Slc25a22 A C 7: 141,431,107 *324G probably null Het
Smarca2 C T 19: 26,776,158 T197I probably benign Het
Speg T C 1: 75,405,149 probably benign Het
Srgap2 T A 1: 131,295,474 N858I unknown Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tbc1d22b T C 17: 29,599,944 I424T probably damaging Het
Tcaf1 T G 6: 42,679,287 T252P probably benign Het
Thbs1 A G 2: 118,113,132 D77G probably damaging Het
Trim21 T C 7: 102,559,468 E348G probably benign Het
Trpm3 A G 19: 22,918,676 D959G probably benign Het
Ttc24 A T 3: 88,072,726 C182* probably null Het
Tti1 T C 2: 158,008,594 T242A probably benign Het
Ube3b G T 5: 114,388,739 C100F probably damaging Het
Vmn1r26 T A 6: 58,008,455 T250S possibly damaging Het
Vnn1 A G 10: 23,904,628 T505A probably benign Het
Vps13a C A 19: 16,664,789 W2158L probably damaging Het
Vwa1 A T 4: 155,772,888 V151E probably damaging Het
Zfp14 A G 7: 30,043,536 S46P probably damaging Het
Zfp773 C A 7: 7,132,571 C342F probably benign Het
Zscan12 T A 13: 21,363,821 S58T possibly damaging Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8326:Slc16a14 UTSW 1 84912345 missense possibly damaging 0.94
R8669:Slc16a14 UTSW 1 84922884 missense probably benign 0.00
R9409:Slc16a14 UTSW 1 84929395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCTCCAGACTTAACAGATTCAG -3'
(R):5'- GGAATTCTGCCTGACACAGC -3'

Sequencing Primer
(F):5'- CTCCAGACTTAACAGATTCAGTGGAG -3'
(R):5'- TGCCTGACACAGCAGGTCTATATG -3'
Posted On 2021-04-30