Incidental Mutation 'R8784:Nsun6'
ID 670454
Institutional Source Beutler Lab
Gene Symbol Nsun6
Ensembl Gene ENSMUSG00000026707
Gene Name NOL1/NOP2/Sun domain family member 6
Synonyms 4933414E04Rik, 4933403D21Rik, NOPD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 14995131-15055069 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 14996495 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 417 (Q417*)
Ref Sequence ENSEMBL: ENSMUSP00000028034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028034] [ENSMUST00000076435] [ENSMUST00000114715] [ENSMUST00000195749]
AlphaFold Q7TS68
Predicted Effect probably null
Transcript: ENSMUST00000028034
AA Change: Q417*
SMART Domains Protein: ENSMUSP00000028034
Gene: ENSMUSG00000026707
AA Change: Q417*

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076435
AA Change: Q417*
SMART Domains Protein: ENSMUSP00000075766
Gene: ENSMUSG00000026707
AA Change: Q417*

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 224 392 4.7e-9 PFAM
Pfam:Nol1_Nop2_Fmu 227 464 4.7e-48 PFAM
Pfam:Methyltransf_31 232 423 8.8e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114715
AA Change: Q366*
SMART Domains Protein: ENSMUSP00000110363
Gene: ENSMUSG00000026707
AA Change: Q366*

DomainStartEndE-ValueType
PUA 61 152 1.96e-4 SMART
Pfam:FtsJ 165 346 4.5e-9 PFAM
Pfam:Methyltransf_31 181 372 2.3e-10 PFAM
Pfam:Methyltransf_18 183 322 2.8e-9 PFAM
Pfam:Methyltransf_26 184 323 5.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195749
AA Change: Q417*
SMART Domains Protein: ENSMUSP00000141924
Gene: ENSMUSG00000026707
AA Change: Q417*

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,002,601 M614K probably benign Het
Adamts7 G T 9: 90,193,865 V1217L probably null Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Atf7ip A G 6: 136,599,650 D1017G probably damaging Het
Atg2b A C 12: 105,639,241 D1488E probably damaging Het
Atxn2 A G 5: 121,795,028 T805A probably benign Het
Azi2 A T 9: 118,055,892 H223L probably benign Het
Banp T A 8: 122,001,113 S349T probably damaging Het
Bicra A T 7: 15,971,950 I1522N probably damaging Het
Brca2 A T 5: 150,548,661 R2342* probably null Het
C6 T C 15: 4,793,140 C623R probably damaging Het
Cc2d2a T C 5: 43,703,303 Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,912,386 C115Y probably benign Het
Chrm4 T A 2: 91,927,688 M147K probably benign Het
Cit A T 5: 115,846,383 K5* probably null Het
Ciz1 T A 2: 32,370,250 S231T probably benign Het
Crebrf A G 17: 26,742,546 I206V probably benign Het
Cyc1 T C 15: 76,343,663 S34P probably benign Het
Dnah5 A G 15: 28,387,951 I3185M probably benign Het
Dtnbp1 T C 13: 44,922,226 D347G unknown Het
Dzip3 A T 16: 48,931,265 V767E probably damaging Het
E330021D16Rik G A 6: 136,401,731 Q34* probably null Het
Fam57a T C 11: 76,208,115 F237S probably damaging Het
Gdf3 A T 6: 122,606,320 C363S probably damaging Het
Glb1l T C 1: 75,200,331 K487R probably damaging Het
Gm9747 T C 1: 82,234,281 V67A unknown Het
Hoxb2 A G 11: 96,351,910 T34A possibly damaging Het
Ifnk C T 4: 35,152,383 R104C probably damaging Het
Igfbp1 A T 11: 7,201,952 I252F probably damaging Het
Ighv1-74 T C 12: 115,802,860 T47A probably benign Het
Igkv4-62 A T 6: 69,399,962 W68R probably damaging Het
Il23r A G 6: 67,466,417 I234T probably damaging Het
Ints2 T A 11: 86,222,137 I852F probably damaging Het
Ints2 G A 11: 86,225,115 Q763* probably null Het
Jhy T G 9: 40,960,886 H109P probably benign Het
Katna1 T A 10: 7,738,815 V29D possibly damaging Het
Kcng4 T A 8: 119,626,231 E313D probably benign Het
Klf14 T A 6: 30,958,114 H195L probably damaging Het
Lama3 A G 18: 12,421,155 N472S probably benign Het
Layn A T 9: 51,059,481 V254E possibly damaging Het
Lrba A T 3: 86,375,928 S1850C probably damaging Het
Map1s A G 8: 70,906,265 I2V unknown Het
Map3k12 T A 15: 102,505,362 Q58L possibly damaging Het
Minpp1 T C 19: 32,513,996 V358A probably benign Het
Mymk C G 2: 27,071,935 K27N possibly damaging Het
Nek8 T C 11: 78,172,549 K130E probably damaging Het
Ngef T A 1: 87,477,571 S706C probably damaging Het
Ntsr2 G T 12: 16,656,851 Q293H probably damaging Het
Ocln T A 13: 100,539,542 I148F probably damaging Het
Olfr101 A G 17: 37,299,810 I204T probably benign Het
Olfr1180 A T 2: 88,411,747 Y304N probably benign Het
Olfr948 T A 9: 39,318,693 Q307L probably benign Het
Pank3 T G 11: 35,781,585 F272V probably damaging Het
Piezo1 A T 8: 122,496,589 probably benign Het
Plppr4 G A 3: 117,322,541 R556* probably null Het
Polr1a G T 6: 71,950,628 R821L probably benign Het
Ppp1r36 C T 12: 76,439,193 T375I probably benign Het
Ptprj T A 2: 90,460,512 I628F possibly damaging Het
Puf60 C A 15: 76,077,676 V29F unknown Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf1 A G 9: 107,557,842 S179G probably benign Het
Rbm6 A G 9: 107,788,138 S772P possibly damaging Het
Rnf103 T G 6: 71,509,998 S538A probably benign Het
Scoc C A 8: 83,437,616 V58L probably benign Het
Secisbp2l G A 2: 125,760,343 Q366* probably null Het
Slc16a14 T C 1: 84,913,063 T174A probably benign Het
Slc25a22 A C 7: 141,431,107 *324G probably null Het
Smarca2 C T 19: 26,776,158 T197I probably benign Het
Speg T C 1: 75,405,149 probably benign Het
Srgap2 T A 1: 131,295,474 N858I unknown Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tbc1d22b T C 17: 29,599,944 I424T probably damaging Het
Tcaf1 T G 6: 42,679,287 T252P probably benign Het
Thbs1 A G 2: 118,113,132 D77G probably damaging Het
Trim21 T C 7: 102,559,468 E348G probably benign Het
Trpm3 A G 19: 22,918,676 D959G probably benign Het
Ttc24 A T 3: 88,072,726 C182* probably null Het
Tti1 T C 2: 158,008,594 T242A probably benign Het
Ube3b G T 5: 114,388,739 C100F probably damaging Het
Vmn1r26 T A 6: 58,008,455 T250S possibly damaging Het
Vnn1 A G 10: 23,904,628 T505A probably benign Het
Vps13a C A 19: 16,664,789 W2158L probably damaging Het
Vwa1 A T 4: 155,772,888 V151E probably damaging Het
Zfp14 A G 7: 30,043,536 S46P probably damaging Het
Zfp773 C A 7: 7,132,571 C342F probably benign Het
Zscan12 T A 13: 21,363,821 S58T possibly damaging Het
Other mutations in Nsun6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Nsun6 APN 2 15048978 missense possibly damaging 0.69
IGL02347:Nsun6 APN 2 15030020 splice site probably benign
IGL03352:Nsun6 APN 2 14996346 nonsense probably null
R0371:Nsun6 UTSW 2 15030087 missense probably damaging 1.00
R0639:Nsun6 UTSW 2 14996336 missense probably benign
R0737:Nsun6 UTSW 2 14996474 missense probably damaging 1.00
R1076:Nsun6 UTSW 2 15009472 missense probably benign 0.01
R1676:Nsun6 UTSW 2 15047213 nonsense probably null
R1842:Nsun6 UTSW 2 15009477 missense probably damaging 0.98
R1989:Nsun6 UTSW 2 15038184 missense probably benign
R2091:Nsun6 UTSW 2 15039731 critical splice donor site probably null
R2972:Nsun6 UTSW 2 15038072 critical splice donor site probably null
R3276:Nsun6 UTSW 2 15009404 splice site probably benign
R4386:Nsun6 UTSW 2 14996522 missense probably benign 0.05
R4761:Nsun6 UTSW 2 15030061 missense possibly damaging 0.88
R4782:Nsun6 UTSW 2 15036326 missense possibly damaging 0.88
R6701:Nsun6 UTSW 2 15036302 missense probably benign 0.00
R6890:Nsun6 UTSW 2 15048977 missense probably damaging 1.00
R7555:Nsun6 UTSW 2 14996339 missense possibly damaging 0.73
R7587:Nsun6 UTSW 2 15039825 missense probably benign
R7880:Nsun6 UTSW 2 14996379 missense probably damaging 0.99
R7888:Nsun6 UTSW 2 14996544 missense probably benign 0.01
R8160:Nsun6 UTSW 2 15009408 critical splice donor site probably null
R8458:Nsun6 UTSW 2 15030052 missense probably benign
R9320:Nsun6 UTSW 2 15042237 missense probably benign 0.01
Z1177:Nsun6 UTSW 2 15030103 missense probably damaging 1.00
Z1177:Nsun6 UTSW 2 15039820 missense probably benign
Z1192:Nsun6 UTSW 2 15038107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATTTCTGAGAAACCTTCGC -3'
(R):5'- TCCACCGCTCTTAGATTGGC -3'

Sequencing Primer
(F):5'- GAGAAACCTTCGCTTTTGTGC -3'
(R):5'- AGATTGGCATGTGCATCTCAC -3'
Posted On 2021-04-30