Incidental Mutation 'R8784:Cit'
ID 670470
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Name citron
Synonyms CRIK-SK, C030025P15Rik, citron kinase, Cit-k, citron-N
MMRRC Submission 068606-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 115983337-116147006 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 115984442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 5 (K5*)
Ref Sequence ENSEMBL: ENSMUSP00000062049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000137952] [ENSMUST00000141101] [ENSMUST00000148245]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051704
AA Change: K5*
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: K5*

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102560
AA Change: K5*
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: K5*

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112008
AA Change: K5*
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: K5*

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137952
AA Change: K5*
SMART Domains Protein: ENSMUSP00000122745
Gene: ENSMUSG00000029516
AA Change: K5*

DomainStartEndE-ValueType
Pfam:Pkinase 97 175 9.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141101
AA Change: K5*
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: K5*

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148245
AA Change: K5*
SMART Domains Protein: ENSMUSP00000119769
Gene: ENSMUSG00000029516
AA Change: K5*

DomainStartEndE-ValueType
Pfam:Pkinase 97 181 7.6e-12 PFAM
Pfam:Pkinase_Tyr 97 181 9.5e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,652,025 (GRCm39) M614K probably benign Het
Adamts7 G T 9: 90,075,918 (GRCm39) V1217L probably null Het
Adcyap1r1 T A 6: 55,458,100 (GRCm39) N300K probably damaging Het
Atf7ip A G 6: 136,576,648 (GRCm39) D1017G probably damaging Het
Atg2b A C 12: 105,605,500 (GRCm39) D1488E probably damaging Het
Atxn2 A G 5: 121,933,091 (GRCm39) T805A probably benign Het
Azi2 A T 9: 117,884,960 (GRCm39) H223L probably benign Het
Banp T A 8: 122,727,852 (GRCm39) S349T probably damaging Het
Bicra A T 7: 15,705,875 (GRCm39) I1522N probably damaging Het
Brca2 A T 5: 150,472,126 (GRCm39) R2342* probably null Het
C6 T C 15: 4,822,622 (GRCm39) C623R probably damaging Het
Cc2d2a T C 5: 43,860,645 (GRCm39) Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,803,212 (GRCm39) C115Y probably benign Het
Chrm4 T A 2: 91,758,033 (GRCm39) M147K probably benign Het
Ciz1 T A 2: 32,260,262 (GRCm39) S231T probably benign Het
Crebrf A G 17: 26,961,520 (GRCm39) I206V probably benign Het
Cyc1 T C 15: 76,227,863 (GRCm39) S34P probably benign Het
Dnah5 A G 15: 28,388,097 (GRCm39) I3185M probably benign Het
Dtnbp1 T C 13: 45,075,702 (GRCm39) D347G unknown Het
Dzip3 A T 16: 48,751,628 (GRCm39) V767E probably damaging Het
Gdf3 A T 6: 122,583,279 (GRCm39) C363S probably damaging Het
Glb1l T C 1: 75,176,975 (GRCm39) K487R probably damaging Het
Gm9747 T C 1: 82,212,002 (GRCm39) V67A unknown Het
Hoxb2 A G 11: 96,242,736 (GRCm39) T34A possibly damaging Het
Ifnk C T 4: 35,152,383 (GRCm39) R104C probably damaging Het
Igfbp1 A T 11: 7,151,952 (GRCm39) I252F probably damaging Het
Ighv1-74 T C 12: 115,766,480 (GRCm39) T47A probably benign Het
Igkv4-62 A T 6: 69,376,946 (GRCm39) W68R probably damaging Het
Il23r A G 6: 67,443,401 (GRCm39) I234T probably damaging Het
Ints2 T A 11: 86,112,963 (GRCm39) I852F probably damaging Het
Ints2 G A 11: 86,115,941 (GRCm39) Q763* probably null Het
Jhy T G 9: 40,872,182 (GRCm39) H109P probably benign Het
Katna1 T A 10: 7,614,579 (GRCm39) V29D possibly damaging Het
Kcng4 T A 8: 120,352,970 (GRCm39) E313D probably benign Het
Klf14 T A 6: 30,935,049 (GRCm39) H195L probably damaging Het
Lama3 A G 18: 12,554,212 (GRCm39) N472S probably benign Het
Layn A T 9: 50,970,781 (GRCm39) V254E possibly damaging Het
Lrba A T 3: 86,283,235 (GRCm39) S1850C probably damaging Het
Map1s A G 8: 71,358,909 (GRCm39) I2V unknown Het
Map3k12 T A 15: 102,413,797 (GRCm39) Q58L possibly damaging Het
Minpp1 T C 19: 32,491,396 (GRCm39) V358A probably benign Het
Mymk C G 2: 26,961,947 (GRCm39) K27N possibly damaging Het
Nek8 T C 11: 78,063,375 (GRCm39) K130E probably damaging Het
Ngef T A 1: 87,405,293 (GRCm39) S706C probably damaging Het
Nsun6 G A 2: 15,001,306 (GRCm39) Q417* probably null Het
Ntsr2 G T 12: 16,706,852 (GRCm39) Q293H probably damaging Het
Ocln T A 13: 100,676,050 (GRCm39) I148F probably damaging Het
Or12d12 A G 17: 37,610,701 (GRCm39) I204T probably benign Het
Or4p19 A T 2: 88,242,091 (GRCm39) Y304N probably benign Het
Or8g30 T A 9: 39,229,989 (GRCm39) Q307L probably benign Het
Pank3 T G 11: 35,672,412 (GRCm39) F272V probably damaging Het
Piezo1 A T 8: 123,223,328 (GRCm39) probably benign Het
Plppr4 G A 3: 117,116,190 (GRCm39) R556* probably null Het
Polr1a G T 6: 71,927,612 (GRCm39) R821L probably benign Het
Ppp1r36 C T 12: 76,485,967 (GRCm39) T375I probably benign Het
Ptprj T A 2: 90,290,856 (GRCm39) I628F possibly damaging Het
Puf60 C A 15: 75,949,525 (GRCm39) V29F unknown Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rassf1 A G 9: 107,435,041 (GRCm39) S179G probably benign Het
Rbm6 A G 9: 107,665,337 (GRCm39) S772P possibly damaging Het
Rnf103 T G 6: 71,486,982 (GRCm39) S538A probably benign Het
Scoc C A 8: 84,164,245 (GRCm39) V58L probably benign Het
Secisbp2l G A 2: 125,602,263 (GRCm39) Q366* probably null Het
Slc16a14 T C 1: 84,890,784 (GRCm39) T174A probably benign Het
Slc25a22 A C 7: 141,011,020 (GRCm39) *324G probably null Het
Smarca2 C T 19: 26,753,558 (GRCm39) T197I probably benign Het
Speg T C 1: 75,381,793 (GRCm39) probably benign Het
Srgap2 T A 1: 131,223,212 (GRCm39) N858I unknown Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Tbc1d22b T C 17: 29,818,918 (GRCm39) I424T probably damaging Het
Tcaf1 T G 6: 42,656,221 (GRCm39) T252P probably benign Het
Thbs1 A G 2: 117,943,613 (GRCm39) D77G probably damaging Het
Tlcd3a T C 11: 76,098,941 (GRCm39) F237S probably damaging Het
Trim21 T C 7: 102,208,675 (GRCm39) E348G probably benign Het
Trpm3 A G 19: 22,896,040 (GRCm39) D959G probably benign Het
Ttc24 A T 3: 87,980,033 (GRCm39) C182* probably null Het
Tti1 T C 2: 157,850,514 (GRCm39) T242A probably benign Het
Ube2q2l G A 6: 136,378,729 (GRCm39) Q34* probably null Het
Ube3b G T 5: 114,526,800 (GRCm39) C100F probably damaging Het
Vmn1r26 T A 6: 57,985,440 (GRCm39) T250S possibly damaging Het
Vnn1 A G 10: 23,780,526 (GRCm39) T505A probably benign Het
Vps13a C A 19: 16,642,153 (GRCm39) W2158L probably damaging Het
Vwa1 A T 4: 155,857,345 (GRCm39) V151E probably damaging Het
Zfp14 A G 7: 29,742,961 (GRCm39) S46P probably damaging Het
Zfp773 C A 7: 7,135,570 (GRCm39) C342F probably benign Het
Zscan12 T A 13: 21,547,991 (GRCm39) S58T possibly damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115,984,524 (GRCm39) missense probably damaging 0.99
IGL00482:Cit APN 5 116,076,814 (GRCm39) missense probably damaging 0.97
IGL01317:Cit APN 5 116,046,775 (GRCm39) missense probably benign 0.03
IGL01335:Cit APN 5 116,046,889 (GRCm39) splice site probably benign
IGL01415:Cit APN 5 116,079,962 (GRCm39) missense possibly damaging 0.78
IGL01447:Cit APN 5 116,011,902 (GRCm39) splice site probably benign
IGL01537:Cit APN 5 116,071,913 (GRCm39) missense probably benign 0.00
IGL01621:Cit APN 5 116,130,662 (GRCm39) splice site probably benign
IGL02010:Cit APN 5 116,014,006 (GRCm39) missense probably damaging 1.00
IGL02538:Cit APN 5 116,125,048 (GRCm39) nonsense probably null
IGL02607:Cit APN 5 115,997,268 (GRCm39) missense probably benign
IGL02720:Cit APN 5 116,133,511 (GRCm39) missense probably benign 0.26
IGL02725:Cit APN 5 116,123,532 (GRCm39) missense probably benign 0.02
IGL02967:Cit APN 5 116,083,896 (GRCm39) missense probably benign 0.11
IGL02973:Cit APN 5 116,144,058 (GRCm39) missense possibly damaging 0.73
IGL03383:Cit APN 5 116,011,904 (GRCm39) splice site probably benign
PIT4514001:Cit UTSW 5 116,135,913 (GRCm39) critical splice donor site probably null
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0226:Cit UTSW 5 116,122,899 (GRCm39) missense probably damaging 0.99
R0320:Cit UTSW 5 116,117,504 (GRCm39) missense possibly damaging 0.87
R0401:Cit UTSW 5 116,123,538 (GRCm39) missense probably benign 0.06
R0480:Cit UTSW 5 116,071,452 (GRCm39) splice site probably benign
R0609:Cit UTSW 5 116,012,002 (GRCm39) missense probably damaging 0.98
R0737:Cit UTSW 5 116,084,978 (GRCm39) missense probably damaging 1.00
R1238:Cit UTSW 5 115,989,280 (GRCm39) missense probably benign 0.30
R1503:Cit UTSW 5 116,011,959 (GRCm39) missense possibly damaging 0.94
R1551:Cit UTSW 5 116,083,901 (GRCm39) missense probably benign 0.00
R1602:Cit UTSW 5 116,135,789 (GRCm39) missense probably damaging 1.00
R1720:Cit UTSW 5 116,105,956 (GRCm39) missense probably damaging 0.98
R1854:Cit UTSW 5 116,011,960 (GRCm39) missense probably damaging 1.00
R1886:Cit UTSW 5 116,071,545 (GRCm39) missense probably damaging 1.00
R2024:Cit UTSW 5 116,143,899 (GRCm39) missense probably damaging 0.97
R2024:Cit UTSW 5 116,085,983 (GRCm39) missense probably damaging 0.97
R2048:Cit UTSW 5 116,024,872 (GRCm39) splice site probably null
R2128:Cit UTSW 5 116,123,566 (GRCm39) missense possibly damaging 0.63
R2192:Cit UTSW 5 116,106,068 (GRCm39) missense probably benign 0.00
R2244:Cit UTSW 5 116,064,564 (GRCm39) missense probably damaging 1.00
R2518:Cit UTSW 5 116,125,105 (GRCm39) missense probably damaging 0.99
R2679:Cit UTSW 5 116,107,174 (GRCm39) missense probably benign 0.00
R2898:Cit UTSW 5 116,012,037 (GRCm39) splice site probably null
R2908:Cit UTSW 5 116,119,735 (GRCm39) missense probably benign 0.00
R3079:Cit UTSW 5 116,063,545 (GRCm39) missense probably damaging 0.97
R3779:Cit UTSW 5 115,997,400 (GRCm39) missense probably benign 0.01
R4081:Cit UTSW 5 116,086,109 (GRCm39) missense probably damaging 1.00
R4494:Cit UTSW 5 116,012,043 (GRCm39) missense probably damaging 1.00
R4610:Cit UTSW 5 116,132,146 (GRCm39) missense probably benign 0.01
R4757:Cit UTSW 5 116,135,608 (GRCm39) missense probably damaging 1.00
R4788:Cit UTSW 5 116,071,565 (GRCm39) missense probably damaging 1.00
R4816:Cit UTSW 5 116,046,750 (GRCm39) missense probably damaging 1.00
R4890:Cit UTSW 5 116,126,182 (GRCm39) intron probably benign
R4899:Cit UTSW 5 116,001,087 (GRCm39) missense possibly damaging 0.60
R4928:Cit UTSW 5 116,123,856 (GRCm39) missense probably benign 0.00
R5073:Cit UTSW 5 116,084,902 (GRCm39) missense probably benign 0.24
R5151:Cit UTSW 5 116,117,894 (GRCm39) missense probably damaging 1.00
R5154:Cit UTSW 5 116,126,464 (GRCm39) missense probably damaging 1.00
R5222:Cit UTSW 5 116,090,602 (GRCm39) missense probably benign 0.03
R5814:Cit UTSW 5 116,117,478 (GRCm39) missense probably damaging 1.00
R5935:Cit UTSW 5 116,063,598 (GRCm39) intron probably benign
R5946:Cit UTSW 5 116,135,593 (GRCm39) missense probably damaging 1.00
R6051:Cit UTSW 5 115,984,464 (GRCm39) missense probably benign
R6289:Cit UTSW 5 116,144,385 (GRCm39) makesense probably null
R6298:Cit UTSW 5 116,086,124 (GRCm39) missense probably damaging 1.00
R6362:Cit UTSW 5 116,024,735 (GRCm39) missense probably benign 0.01
R6545:Cit UTSW 5 115,984,493 (GRCm39) missense probably null 0.00
R6761:Cit UTSW 5 116,046,734 (GRCm39) missense probably damaging 1.00
R6798:Cit UTSW 5 116,064,585 (GRCm39) missense possibly damaging 0.56
R6814:Cit UTSW 5 116,023,022 (GRCm39) missense probably damaging 1.00
R6825:Cit UTSW 5 116,119,833 (GRCm39) missense probably damaging 0.99
R6845:Cit UTSW 5 116,122,947 (GRCm39) missense probably damaging 1.00
R6983:Cit UTSW 5 116,132,150 (GRCm39) missense probably damaging 1.00
R7164:Cit UTSW 5 116,123,846 (GRCm39) missense possibly damaging 0.94
R7359:Cit UTSW 5 116,064,633 (GRCm39) missense probably damaging 1.00
R7597:Cit UTSW 5 116,024,740 (GRCm39) nonsense probably null
R7729:Cit UTSW 5 116,122,881 (GRCm39) missense possibly damaging 0.87
R7763:Cit UTSW 5 116,125,060 (GRCm39) missense probably benign 0.01
R7786:Cit UTSW 5 116,001,077 (GRCm39) missense probably benign 0.00
R7799:Cit UTSW 5 116,001,027 (GRCm39) missense probably benign 0.00
R8060:Cit UTSW 5 116,046,786 (GRCm39) missense probably benign 0.00
R8068:Cit UTSW 5 116,120,294 (GRCm39) missense probably benign 0.03
R8068:Cit UTSW 5 116,090,525 (GRCm39) missense probably damaging 1.00
R8122:Cit UTSW 5 116,107,069 (GRCm39) missense probably damaging 1.00
R8177:Cit UTSW 5 116,126,218 (GRCm39) missense probably benign 0.18
R8178:Cit UTSW 5 116,107,131 (GRCm39) missense probably damaging 1.00
R8265:Cit UTSW 5 116,126,236 (GRCm39) missense probably damaging 1.00
R8359:Cit UTSW 5 116,122,603 (GRCm39) splice site probably null
R8397:Cit UTSW 5 116,024,856 (GRCm39) missense probably benign
R8489:Cit UTSW 5 116,083,962 (GRCm39) critical splice donor site probably null
R8798:Cit UTSW 5 116,107,102 (GRCm39) missense probably damaging 0.99
R8882:Cit UTSW 5 116,001,089 (GRCm39) missense probably benign 0.04
R8984:Cit UTSW 5 116,064,534 (GRCm39) missense possibly damaging 0.86
R9091:Cit UTSW 5 115,984,161 (GRCm39) intron probably benign
R9127:Cit UTSW 5 116,074,896 (GRCm39) nonsense probably null
R9204:Cit UTSW 5 116,126,498 (GRCm39) missense probably damaging 0.99
R9212:Cit UTSW 5 116,013,952 (GRCm39) missense possibly damaging 0.75
R9279:Cit UTSW 5 116,065,970 (GRCm39) missense probably damaging 1.00
R9288:Cit UTSW 5 116,123,512 (GRCm39) missense probably damaging 1.00
R9377:Cit UTSW 5 116,084,914 (GRCm39) missense probably benign 0.04
R9520:Cit UTSW 5 116,079,954 (GRCm39) nonsense probably null
Z1088:Cit UTSW 5 116,123,592 (GRCm39) missense possibly damaging 0.62
Z1176:Cit UTSW 5 116,124,662 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGTCCACCAATGGCTG -3'
(R):5'- ACCCTAAGAATACCAGTCTCTGTCC -3'

Sequencing Primer
(F):5'- CCTTATGTGTATGAGTACCTTTGGCC -3'
(R):5'- AGAATACCAGTCTCTGTCCATAATAC -3'
Posted On 2021-04-30