Incidental Mutation 'R8784:Atxn2'
ID 670471
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 068606-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121933091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 805 (T805A)
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000161064] [ENSMUST00000162327]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051950
AA Change: T805A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: T805A

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160821
SMART Domains Protein: ENSMUSP00000125647
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
Pfam:LsmAD 1 47 3.6e-11 PFAM
low complexity region 217 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161064
AA Change: T496A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: T496A

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162327
AA Change: T201A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: T201A

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,652,025 (GRCm39) M614K probably benign Het
Adamts7 G T 9: 90,075,918 (GRCm39) V1217L probably null Het
Adcyap1r1 T A 6: 55,458,100 (GRCm39) N300K probably damaging Het
Atf7ip A G 6: 136,576,648 (GRCm39) D1017G probably damaging Het
Atg2b A C 12: 105,605,500 (GRCm39) D1488E probably damaging Het
Azi2 A T 9: 117,884,960 (GRCm39) H223L probably benign Het
Banp T A 8: 122,727,852 (GRCm39) S349T probably damaging Het
Bicra A T 7: 15,705,875 (GRCm39) I1522N probably damaging Het
Brca2 A T 5: 150,472,126 (GRCm39) R2342* probably null Het
C6 T C 15: 4,822,622 (GRCm39) C623R probably damaging Het
Cc2d2a T C 5: 43,860,645 (GRCm39) Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,803,212 (GRCm39) C115Y probably benign Het
Chrm4 T A 2: 91,758,033 (GRCm39) M147K probably benign Het
Cit A T 5: 115,984,442 (GRCm39) K5* probably null Het
Ciz1 T A 2: 32,260,262 (GRCm39) S231T probably benign Het
Crebrf A G 17: 26,961,520 (GRCm39) I206V probably benign Het
Cyc1 T C 15: 76,227,863 (GRCm39) S34P probably benign Het
Dnah5 A G 15: 28,388,097 (GRCm39) I3185M probably benign Het
Dtnbp1 T C 13: 45,075,702 (GRCm39) D347G unknown Het
Dzip3 A T 16: 48,751,628 (GRCm39) V767E probably damaging Het
Gdf3 A T 6: 122,583,279 (GRCm39) C363S probably damaging Het
Glb1l T C 1: 75,176,975 (GRCm39) K487R probably damaging Het
Gm9747 T C 1: 82,212,002 (GRCm39) V67A unknown Het
Hoxb2 A G 11: 96,242,736 (GRCm39) T34A possibly damaging Het
Ifnk C T 4: 35,152,383 (GRCm39) R104C probably damaging Het
Igfbp1 A T 11: 7,151,952 (GRCm39) I252F probably damaging Het
Ighv1-74 T C 12: 115,766,480 (GRCm39) T47A probably benign Het
Igkv4-62 A T 6: 69,376,946 (GRCm39) W68R probably damaging Het
Il23r A G 6: 67,443,401 (GRCm39) I234T probably damaging Het
Ints2 T A 11: 86,112,963 (GRCm39) I852F probably damaging Het
Ints2 G A 11: 86,115,941 (GRCm39) Q763* probably null Het
Jhy T G 9: 40,872,182 (GRCm39) H109P probably benign Het
Katna1 T A 10: 7,614,579 (GRCm39) V29D possibly damaging Het
Kcng4 T A 8: 120,352,970 (GRCm39) E313D probably benign Het
Klf14 T A 6: 30,935,049 (GRCm39) H195L probably damaging Het
Lama3 A G 18: 12,554,212 (GRCm39) N472S probably benign Het
Layn A T 9: 50,970,781 (GRCm39) V254E possibly damaging Het
Lrba A T 3: 86,283,235 (GRCm39) S1850C probably damaging Het
Map1s A G 8: 71,358,909 (GRCm39) I2V unknown Het
Map3k12 T A 15: 102,413,797 (GRCm39) Q58L possibly damaging Het
Minpp1 T C 19: 32,491,396 (GRCm39) V358A probably benign Het
Mymk C G 2: 26,961,947 (GRCm39) K27N possibly damaging Het
Nek8 T C 11: 78,063,375 (GRCm39) K130E probably damaging Het
Ngef T A 1: 87,405,293 (GRCm39) S706C probably damaging Het
Nsun6 G A 2: 15,001,306 (GRCm39) Q417* probably null Het
Ntsr2 G T 12: 16,706,852 (GRCm39) Q293H probably damaging Het
Ocln T A 13: 100,676,050 (GRCm39) I148F probably damaging Het
Or12d12 A G 17: 37,610,701 (GRCm39) I204T probably benign Het
Or4p19 A T 2: 88,242,091 (GRCm39) Y304N probably benign Het
Or8g30 T A 9: 39,229,989 (GRCm39) Q307L probably benign Het
Pank3 T G 11: 35,672,412 (GRCm39) F272V probably damaging Het
Piezo1 A T 8: 123,223,328 (GRCm39) probably benign Het
Plppr4 G A 3: 117,116,190 (GRCm39) R556* probably null Het
Polr1a G T 6: 71,927,612 (GRCm39) R821L probably benign Het
Ppp1r36 C T 12: 76,485,967 (GRCm39) T375I probably benign Het
Ptprj T A 2: 90,290,856 (GRCm39) I628F possibly damaging Het
Puf60 C A 15: 75,949,525 (GRCm39) V29F unknown Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rassf1 A G 9: 107,435,041 (GRCm39) S179G probably benign Het
Rbm6 A G 9: 107,665,337 (GRCm39) S772P possibly damaging Het
Rnf103 T G 6: 71,486,982 (GRCm39) S538A probably benign Het
Scoc C A 8: 84,164,245 (GRCm39) V58L probably benign Het
Secisbp2l G A 2: 125,602,263 (GRCm39) Q366* probably null Het
Slc16a14 T C 1: 84,890,784 (GRCm39) T174A probably benign Het
Slc25a22 A C 7: 141,011,020 (GRCm39) *324G probably null Het
Smarca2 C T 19: 26,753,558 (GRCm39) T197I probably benign Het
Speg T C 1: 75,381,793 (GRCm39) probably benign Het
Srgap2 T A 1: 131,223,212 (GRCm39) N858I unknown Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Tbc1d22b T C 17: 29,818,918 (GRCm39) I424T probably damaging Het
Tcaf1 T G 6: 42,656,221 (GRCm39) T252P probably benign Het
Thbs1 A G 2: 117,943,613 (GRCm39) D77G probably damaging Het
Tlcd3a T C 11: 76,098,941 (GRCm39) F237S probably damaging Het
Trim21 T C 7: 102,208,675 (GRCm39) E348G probably benign Het
Trpm3 A G 19: 22,896,040 (GRCm39) D959G probably benign Het
Ttc24 A T 3: 87,980,033 (GRCm39) C182* probably null Het
Tti1 T C 2: 157,850,514 (GRCm39) T242A probably benign Het
Ube2q2l G A 6: 136,378,729 (GRCm39) Q34* probably null Het
Ube3b G T 5: 114,526,800 (GRCm39) C100F probably damaging Het
Vmn1r26 T A 6: 57,985,440 (GRCm39) T250S possibly damaging Het
Vnn1 A G 10: 23,780,526 (GRCm39) T505A probably benign Het
Vps13a C A 19: 16,642,153 (GRCm39) W2158L probably damaging Het
Vwa1 A T 4: 155,857,345 (GRCm39) V151E probably damaging Het
Zfp14 A G 7: 29,742,961 (GRCm39) S46P probably damaging Het
Zfp773 C A 7: 7,135,570 (GRCm39) C342F probably benign Het
Zscan12 T A 13: 21,547,991 (GRCm39) S58T possibly damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTCTTAACAAACAGACAAGTCC -3'
(R):5'- TGCTGAGACCCAGGTTACTC -3'

Sequencing Primer
(F):5'- GTCCACCAAAAAGGCCATATTCTG -3'
(R):5'- GAGACCCAGGTTACTCACTCTG -3'
Posted On 2021-04-30