Incidental Mutation 'R8784:Syna'
ID 670472
Institutional Source Beutler Lab
Gene Symbol Syna
Ensembl Gene ENSMUSG00000085957
Gene Name syncytin a
Synonyms syncytin-A, Gm52
MMRRC Submission 068606-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 134587000-134589025 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 134588723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 75 (M75I)
Ref Sequence ENSEMBL: ENSMUSP00000116437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149604]
AlphaFold Q5G5D5
Predicted Effect probably benign
Transcript: ENSMUST00000149604
AA Change: M75I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000116437
Gene: ENSMUSG00000085957
AA Change: M75I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:TLV_coat 333 578 1.9e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: Many different endogenous retrovirus families are expressed in normal placental tissue at high levels, suggesting that endogenous retroviruses are functionally important in reproduction. This gene is part of a mouse endogenous retrovirus provirus on chromosome 5 that has inactivating mutations in the gag and pol genes. This gene is the envelope glycoprotein gene which appears to have been selectively preserved. The gene's protein product plays a major role in placental development and trophoblast fusion. The protein has the characteristics of a typical retroviral envelope protein, including a cleavage site that separates the surface (SU) and transmembrane (TM) proteins which form a heterodimer. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E11.5 and E14.5 associated with defective placental layrinth formation, impaired placental transport, and increased trophoblast cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 45,652,025 (GRCm39) M614K probably benign Het
Adamts7 G T 9: 90,075,918 (GRCm39) V1217L probably null Het
Adcyap1r1 T A 6: 55,458,100 (GRCm39) N300K probably damaging Het
Atf7ip A G 6: 136,576,648 (GRCm39) D1017G probably damaging Het
Atg2b A C 12: 105,605,500 (GRCm39) D1488E probably damaging Het
Atxn2 A G 5: 121,933,091 (GRCm39) T805A probably benign Het
Azi2 A T 9: 117,884,960 (GRCm39) H223L probably benign Het
Banp T A 8: 122,727,852 (GRCm39) S349T probably damaging Het
Bicra A T 7: 15,705,875 (GRCm39) I1522N probably damaging Het
Brca2 A T 5: 150,472,126 (GRCm39) R2342* probably null Het
C6 T C 15: 4,822,622 (GRCm39) C623R probably damaging Het
Cc2d2a T C 5: 43,860,645 (GRCm39) Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,803,212 (GRCm39) C115Y probably benign Het
Chrm4 T A 2: 91,758,033 (GRCm39) M147K probably benign Het
Cit A T 5: 115,984,442 (GRCm39) K5* probably null Het
Ciz1 T A 2: 32,260,262 (GRCm39) S231T probably benign Het
Crebrf A G 17: 26,961,520 (GRCm39) I206V probably benign Het
Cyc1 T C 15: 76,227,863 (GRCm39) S34P probably benign Het
Dnah5 A G 15: 28,388,097 (GRCm39) I3185M probably benign Het
Dtnbp1 T C 13: 45,075,702 (GRCm39) D347G unknown Het
Dzip3 A T 16: 48,751,628 (GRCm39) V767E probably damaging Het
Gdf3 A T 6: 122,583,279 (GRCm39) C363S probably damaging Het
Glb1l T C 1: 75,176,975 (GRCm39) K487R probably damaging Het
Gm9747 T C 1: 82,212,002 (GRCm39) V67A unknown Het
Hoxb2 A G 11: 96,242,736 (GRCm39) T34A possibly damaging Het
Ifnk C T 4: 35,152,383 (GRCm39) R104C probably damaging Het
Igfbp1 A T 11: 7,151,952 (GRCm39) I252F probably damaging Het
Ighv1-74 T C 12: 115,766,480 (GRCm39) T47A probably benign Het
Igkv4-62 A T 6: 69,376,946 (GRCm39) W68R probably damaging Het
Il23r A G 6: 67,443,401 (GRCm39) I234T probably damaging Het
Ints2 T A 11: 86,112,963 (GRCm39) I852F probably damaging Het
Ints2 G A 11: 86,115,941 (GRCm39) Q763* probably null Het
Jhy T G 9: 40,872,182 (GRCm39) H109P probably benign Het
Katna1 T A 10: 7,614,579 (GRCm39) V29D possibly damaging Het
Kcng4 T A 8: 120,352,970 (GRCm39) E313D probably benign Het
Klf14 T A 6: 30,935,049 (GRCm39) H195L probably damaging Het
Lama3 A G 18: 12,554,212 (GRCm39) N472S probably benign Het
Layn A T 9: 50,970,781 (GRCm39) V254E possibly damaging Het
Lrba A T 3: 86,283,235 (GRCm39) S1850C probably damaging Het
Map1s A G 8: 71,358,909 (GRCm39) I2V unknown Het
Map3k12 T A 15: 102,413,797 (GRCm39) Q58L possibly damaging Het
Minpp1 T C 19: 32,491,396 (GRCm39) V358A probably benign Het
Mymk C G 2: 26,961,947 (GRCm39) K27N possibly damaging Het
Nek8 T C 11: 78,063,375 (GRCm39) K130E probably damaging Het
Ngef T A 1: 87,405,293 (GRCm39) S706C probably damaging Het
Nsun6 G A 2: 15,001,306 (GRCm39) Q417* probably null Het
Ntsr2 G T 12: 16,706,852 (GRCm39) Q293H probably damaging Het
Ocln T A 13: 100,676,050 (GRCm39) I148F probably damaging Het
Or12d12 A G 17: 37,610,701 (GRCm39) I204T probably benign Het
Or4p19 A T 2: 88,242,091 (GRCm39) Y304N probably benign Het
Or8g30 T A 9: 39,229,989 (GRCm39) Q307L probably benign Het
Pank3 T G 11: 35,672,412 (GRCm39) F272V probably damaging Het
Piezo1 A T 8: 123,223,328 (GRCm39) probably benign Het
Plppr4 G A 3: 117,116,190 (GRCm39) R556* probably null Het
Polr1a G T 6: 71,927,612 (GRCm39) R821L probably benign Het
Ppp1r36 C T 12: 76,485,967 (GRCm39) T375I probably benign Het
Ptprj T A 2: 90,290,856 (GRCm39) I628F possibly damaging Het
Puf60 C A 15: 75,949,525 (GRCm39) V29F unknown Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rassf1 A G 9: 107,435,041 (GRCm39) S179G probably benign Het
Rbm6 A G 9: 107,665,337 (GRCm39) S772P possibly damaging Het
Rnf103 T G 6: 71,486,982 (GRCm39) S538A probably benign Het
Scoc C A 8: 84,164,245 (GRCm39) V58L probably benign Het
Secisbp2l G A 2: 125,602,263 (GRCm39) Q366* probably null Het
Slc16a14 T C 1: 84,890,784 (GRCm39) T174A probably benign Het
Slc25a22 A C 7: 141,011,020 (GRCm39) *324G probably null Het
Smarca2 C T 19: 26,753,558 (GRCm39) T197I probably benign Het
Speg T C 1: 75,381,793 (GRCm39) probably benign Het
Srgap2 T A 1: 131,223,212 (GRCm39) N858I unknown Het
Tbc1d22b T C 17: 29,818,918 (GRCm39) I424T probably damaging Het
Tcaf1 T G 6: 42,656,221 (GRCm39) T252P probably benign Het
Thbs1 A G 2: 117,943,613 (GRCm39) D77G probably damaging Het
Tlcd3a T C 11: 76,098,941 (GRCm39) F237S probably damaging Het
Trim21 T C 7: 102,208,675 (GRCm39) E348G probably benign Het
Trpm3 A G 19: 22,896,040 (GRCm39) D959G probably benign Het
Ttc24 A T 3: 87,980,033 (GRCm39) C182* probably null Het
Tti1 T C 2: 157,850,514 (GRCm39) T242A probably benign Het
Ube2q2l G A 6: 136,378,729 (GRCm39) Q34* probably null Het
Ube3b G T 5: 114,526,800 (GRCm39) C100F probably damaging Het
Vmn1r26 T A 6: 57,985,440 (GRCm39) T250S possibly damaging Het
Vnn1 A G 10: 23,780,526 (GRCm39) T505A probably benign Het
Vps13a C A 19: 16,642,153 (GRCm39) W2158L probably damaging Het
Vwa1 A T 4: 155,857,345 (GRCm39) V151E probably damaging Het
Zfp14 A G 7: 29,742,961 (GRCm39) S46P probably damaging Het
Zfp773 C A 7: 7,135,570 (GRCm39) C342F probably benign Het
Zscan12 T A 13: 21,547,991 (GRCm39) S58T possibly damaging Het
Other mutations in Syna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syna APN 5 134,588,571 (GRCm39) missense possibly damaging 0.94
IGL01128:Syna APN 5 134,588,334 (GRCm39) missense probably damaging 0.99
IGL03183:Syna APN 5 134,587,144 (GRCm39) missense probably benign 0.03
R0051:Syna UTSW 5 134,588,397 (GRCm39) missense probably damaging 1.00
R0051:Syna UTSW 5 134,588,397 (GRCm39) missense probably damaging 0.99
R0137:Syna UTSW 5 134,588,314 (GRCm39) missense possibly damaging 0.93
R0920:Syna UTSW 5 134,587,956 (GRCm39) missense probably benign 0.12
R1525:Syna UTSW 5 134,588,112 (GRCm39) missense probably benign
R1801:Syna UTSW 5 134,588,943 (GRCm39) missense probably benign 0.02
R1813:Syna UTSW 5 134,588,006 (GRCm39) missense probably benign 0.06
R1866:Syna UTSW 5 134,588,769 (GRCm39) missense probably damaging 1.00
R1887:Syna UTSW 5 134,588,106 (GRCm39) missense probably benign
R1896:Syna UTSW 5 134,588,006 (GRCm39) missense probably benign 0.06
R2139:Syna UTSW 5 134,588,106 (GRCm39) nonsense probably null
R3896:Syna UTSW 5 134,587,165 (GRCm39) nonsense probably null
R4674:Syna UTSW 5 134,587,209 (GRCm39) missense probably damaging 0.99
R4730:Syna UTSW 5 134,587,440 (GRCm39) missense probably damaging 1.00
R5124:Syna UTSW 5 134,588,424 (GRCm39) missense possibly damaging 0.65
R5482:Syna UTSW 5 134,588,028 (GRCm39) missense possibly damaging 0.94
R6130:Syna UTSW 5 134,587,122 (GRCm39) missense possibly damaging 0.72
R6196:Syna UTSW 5 134,588,466 (GRCm39) missense probably benign 0.14
R6243:Syna UTSW 5 134,588,968 (GRCm39) start gained probably benign
R6945:Syna UTSW 5 134,587,815 (GRCm39) missense probably damaging 0.97
R7999:Syna UTSW 5 134,588,046 (GRCm39) missense probably benign
R8320:Syna UTSW 5 134,588,574 (GRCm39) missense possibly damaging 0.86
R8783:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
R8785:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
R8786:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
R8787:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
X0022:Syna UTSW 5 134,588,427 (GRCm39) missense probably benign 0.01
Z1088:Syna UTSW 5 134,587,383 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTCATCGGGGTATCTCAC -3'
(R):5'- TCCTGAAGAGCCATGGTTCG -3'

Sequencing Primer
(F):5'- CCGAGGTGATCCGAGAAAGTATG -3'
(R):5'- AAGAGCCATGGTTCGTCCTTG -3'
Posted On 2021-04-30