Incidental Mutation 'R8784:Abcc6'
ID 670488
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 068606-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.788) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45652025 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 614 (M614K)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: M614K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: M614K

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 G T 9: 90,075,918 (GRCm39) V1217L probably null Het
Adcyap1r1 T A 6: 55,458,100 (GRCm39) N300K probably damaging Het
Atf7ip A G 6: 136,576,648 (GRCm39) D1017G probably damaging Het
Atg2b A C 12: 105,605,500 (GRCm39) D1488E probably damaging Het
Atxn2 A G 5: 121,933,091 (GRCm39) T805A probably benign Het
Azi2 A T 9: 117,884,960 (GRCm39) H223L probably benign Het
Banp T A 8: 122,727,852 (GRCm39) S349T probably damaging Het
Bicra A T 7: 15,705,875 (GRCm39) I1522N probably damaging Het
Brca2 A T 5: 150,472,126 (GRCm39) R2342* probably null Het
C6 T C 15: 4,822,622 (GRCm39) C623R probably damaging Het
Cc2d2a T C 5: 43,860,645 (GRCm39) Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,803,212 (GRCm39) C115Y probably benign Het
Chrm4 T A 2: 91,758,033 (GRCm39) M147K probably benign Het
Cit A T 5: 115,984,442 (GRCm39) K5* probably null Het
Ciz1 T A 2: 32,260,262 (GRCm39) S231T probably benign Het
Crebrf A G 17: 26,961,520 (GRCm39) I206V probably benign Het
Cyc1 T C 15: 76,227,863 (GRCm39) S34P probably benign Het
Dnah5 A G 15: 28,388,097 (GRCm39) I3185M probably benign Het
Dtnbp1 T C 13: 45,075,702 (GRCm39) D347G unknown Het
Dzip3 A T 16: 48,751,628 (GRCm39) V767E probably damaging Het
Gdf3 A T 6: 122,583,279 (GRCm39) C363S probably damaging Het
Glb1l T C 1: 75,176,975 (GRCm39) K487R probably damaging Het
Gm9747 T C 1: 82,212,002 (GRCm39) V67A unknown Het
Hoxb2 A G 11: 96,242,736 (GRCm39) T34A possibly damaging Het
Ifnk C T 4: 35,152,383 (GRCm39) R104C probably damaging Het
Igfbp1 A T 11: 7,151,952 (GRCm39) I252F probably damaging Het
Ighv1-74 T C 12: 115,766,480 (GRCm39) T47A probably benign Het
Igkv4-62 A T 6: 69,376,946 (GRCm39) W68R probably damaging Het
Il23r A G 6: 67,443,401 (GRCm39) I234T probably damaging Het
Ints2 T A 11: 86,112,963 (GRCm39) I852F probably damaging Het
Ints2 G A 11: 86,115,941 (GRCm39) Q763* probably null Het
Jhy T G 9: 40,872,182 (GRCm39) H109P probably benign Het
Katna1 T A 10: 7,614,579 (GRCm39) V29D possibly damaging Het
Kcng4 T A 8: 120,352,970 (GRCm39) E313D probably benign Het
Klf14 T A 6: 30,935,049 (GRCm39) H195L probably damaging Het
Lama3 A G 18: 12,554,212 (GRCm39) N472S probably benign Het
Layn A T 9: 50,970,781 (GRCm39) V254E possibly damaging Het
Lrba A T 3: 86,283,235 (GRCm39) S1850C probably damaging Het
Map1s A G 8: 71,358,909 (GRCm39) I2V unknown Het
Map3k12 T A 15: 102,413,797 (GRCm39) Q58L possibly damaging Het
Minpp1 T C 19: 32,491,396 (GRCm39) V358A probably benign Het
Mymk C G 2: 26,961,947 (GRCm39) K27N possibly damaging Het
Nek8 T C 11: 78,063,375 (GRCm39) K130E probably damaging Het
Ngef T A 1: 87,405,293 (GRCm39) S706C probably damaging Het
Nsun6 G A 2: 15,001,306 (GRCm39) Q417* probably null Het
Ntsr2 G T 12: 16,706,852 (GRCm39) Q293H probably damaging Het
Ocln T A 13: 100,676,050 (GRCm39) I148F probably damaging Het
Or12d12 A G 17: 37,610,701 (GRCm39) I204T probably benign Het
Or4p19 A T 2: 88,242,091 (GRCm39) Y304N probably benign Het
Or8g30 T A 9: 39,229,989 (GRCm39) Q307L probably benign Het
Pank3 T G 11: 35,672,412 (GRCm39) F272V probably damaging Het
Piezo1 A T 8: 123,223,328 (GRCm39) probably benign Het
Plppr4 G A 3: 117,116,190 (GRCm39) R556* probably null Het
Polr1a G T 6: 71,927,612 (GRCm39) R821L probably benign Het
Ppp1r36 C T 12: 76,485,967 (GRCm39) T375I probably benign Het
Ptprj T A 2: 90,290,856 (GRCm39) I628F possibly damaging Het
Puf60 C A 15: 75,949,525 (GRCm39) V29F unknown Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rassf1 A G 9: 107,435,041 (GRCm39) S179G probably benign Het
Rbm6 A G 9: 107,665,337 (GRCm39) S772P possibly damaging Het
Rnf103 T G 6: 71,486,982 (GRCm39) S538A probably benign Het
Scoc C A 8: 84,164,245 (GRCm39) V58L probably benign Het
Secisbp2l G A 2: 125,602,263 (GRCm39) Q366* probably null Het
Slc16a14 T C 1: 84,890,784 (GRCm39) T174A probably benign Het
Slc25a22 A C 7: 141,011,020 (GRCm39) *324G probably null Het
Smarca2 C T 19: 26,753,558 (GRCm39) T197I probably benign Het
Speg T C 1: 75,381,793 (GRCm39) probably benign Het
Srgap2 T A 1: 131,223,212 (GRCm39) N858I unknown Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Tbc1d22b T C 17: 29,818,918 (GRCm39) I424T probably damaging Het
Tcaf1 T G 6: 42,656,221 (GRCm39) T252P probably benign Het
Thbs1 A G 2: 117,943,613 (GRCm39) D77G probably damaging Het
Tlcd3a T C 11: 76,098,941 (GRCm39) F237S probably damaging Het
Trim21 T C 7: 102,208,675 (GRCm39) E348G probably benign Het
Trpm3 A G 19: 22,896,040 (GRCm39) D959G probably benign Het
Ttc24 A T 3: 87,980,033 (GRCm39) C182* probably null Het
Tti1 T C 2: 157,850,514 (GRCm39) T242A probably benign Het
Ube2q2l G A 6: 136,378,729 (GRCm39) Q34* probably null Het
Ube3b G T 5: 114,526,800 (GRCm39) C100F probably damaging Het
Vmn1r26 T A 6: 57,985,440 (GRCm39) T250S possibly damaging Het
Vnn1 A G 10: 23,780,526 (GRCm39) T505A probably benign Het
Vps13a C A 19: 16,642,153 (GRCm39) W2158L probably damaging Het
Vwa1 A T 4: 155,857,345 (GRCm39) V151E probably damaging Het
Zfp14 A G 7: 29,742,961 (GRCm39) S46P probably damaging Het
Zfp773 C A 7: 7,135,570 (GRCm39) C342F probably benign Het
Zscan12 T A 13: 21,547,991 (GRCm39) S58T possibly damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,634,677 (GRCm39) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2138:Abcc6 UTSW 7 45,630,475 (GRCm39) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4013:Abcc6 UTSW 7 45,668,104 (GRCm39) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,646,115 (GRCm39) missense probably benign
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6178:Abcc6 UTSW 7 45,678,468 (GRCm39) missense probably benign
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7553:Abcc6 UTSW 7 45,648,545 (GRCm39) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 45,655,030 (GRCm39) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATCTAGACTTCTGCATAAGGG -3'
(R):5'- CCACCCATGTCAAGGTCATTG -3'

Sequencing Primer
(F):5'- CTAGACTTCTGCATAAGGGTAAGTTC -3'
(R):5'- AAGGTCATTGTTTCCCATGAGC -3'
Posted On 2021-04-30