Incidental Mutation 'R8784:Abcc6'
ID 670488
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46002601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 614 (M614K)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: M614K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: M614K

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 G T 9: 90,193,865 V1217L probably null Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Atf7ip A G 6: 136,599,650 D1017G probably damaging Het
Atg2b A C 12: 105,639,241 D1488E probably damaging Het
Atxn2 A G 5: 121,795,028 T805A probably benign Het
Azi2 A T 9: 118,055,892 H223L probably benign Het
Banp T A 8: 122,001,113 S349T probably damaging Het
Bicra A T 7: 15,971,950 I1522N probably damaging Het
Brca2 A T 5: 150,548,661 R2342* probably null Het
C6 T C 15: 4,793,140 C623R probably damaging Het
Cc2d2a T C 5: 43,703,303 Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,912,386 C115Y probably benign Het
Chrm4 T A 2: 91,927,688 M147K probably benign Het
Cit A T 5: 115,846,383 K5* probably null Het
Ciz1 T A 2: 32,370,250 S231T probably benign Het
Crebrf A G 17: 26,742,546 I206V probably benign Het
Cyc1 T C 15: 76,343,663 S34P probably benign Het
Dnah5 A G 15: 28,387,951 I3185M probably benign Het
Dtnbp1 T C 13: 44,922,226 D347G unknown Het
Dzip3 A T 16: 48,931,265 V767E probably damaging Het
E330021D16Rik G A 6: 136,401,731 Q34* probably null Het
Fam57a T C 11: 76,208,115 F237S probably damaging Het
Gdf3 A T 6: 122,606,320 C363S probably damaging Het
Glb1l T C 1: 75,200,331 K487R probably damaging Het
Gm9747 T C 1: 82,234,281 V67A unknown Het
Hoxb2 A G 11: 96,351,910 T34A possibly damaging Het
Ifnk C T 4: 35,152,383 R104C probably damaging Het
Igfbp1 A T 11: 7,201,952 I252F probably damaging Het
Ighv1-74 T C 12: 115,802,860 T47A probably benign Het
Igkv4-62 A T 6: 69,399,962 W68R probably damaging Het
Il23r A G 6: 67,466,417 I234T probably damaging Het
Ints2 T A 11: 86,222,137 I852F probably damaging Het
Ints2 G A 11: 86,225,115 Q763* probably null Het
Jhy T G 9: 40,960,886 H109P probably benign Het
Katna1 T A 10: 7,738,815 V29D possibly damaging Het
Kcng4 T A 8: 119,626,231 E313D probably benign Het
Klf14 T A 6: 30,958,114 H195L probably damaging Het
Lama3 A G 18: 12,421,155 N472S probably benign Het
Layn A T 9: 51,059,481 V254E possibly damaging Het
Lrba A T 3: 86,375,928 S1850C probably damaging Het
Map1s A G 8: 70,906,265 I2V unknown Het
Map3k12 T A 15: 102,505,362 Q58L possibly damaging Het
Minpp1 T C 19: 32,513,996 V358A probably benign Het
Mymk C G 2: 27,071,935 K27N possibly damaging Het
Nek8 T C 11: 78,172,549 K130E probably damaging Het
Ngef T A 1: 87,477,571 S706C probably damaging Het
Nsun6 G A 2: 14,996,495 Q417* probably null Het
Ntsr2 G T 12: 16,656,851 Q293H probably damaging Het
Ocln T A 13: 100,539,542 I148F probably damaging Het
Olfr101 A G 17: 37,299,810 I204T probably benign Het
Olfr1180 A T 2: 88,411,747 Y304N probably benign Het
Olfr948 T A 9: 39,318,693 Q307L probably benign Het
Pank3 T G 11: 35,781,585 F272V probably damaging Het
Piezo1 A T 8: 122,496,589 probably benign Het
Plppr4 G A 3: 117,322,541 R556* probably null Het
Polr1a G T 6: 71,950,628 R821L probably benign Het
Ppp1r36 C T 12: 76,439,193 T375I probably benign Het
Ptprj T A 2: 90,460,512 I628F possibly damaging Het
Puf60 C A 15: 76,077,676 V29F unknown Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf1 A G 9: 107,557,842 S179G probably benign Het
Rbm6 A G 9: 107,788,138 S772P possibly damaging Het
Rnf103 T G 6: 71,509,998 S538A probably benign Het
Scoc C A 8: 83,437,616 V58L probably benign Het
Secisbp2l G A 2: 125,760,343 Q366* probably null Het
Slc16a14 T C 1: 84,913,063 T174A probably benign Het
Slc25a22 A C 7: 141,431,107 *324G probably null Het
Smarca2 C T 19: 26,776,158 T197I probably benign Het
Speg T C 1: 75,405,149 probably benign Het
Srgap2 T A 1: 131,295,474 N858I unknown Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tbc1d22b T C 17: 29,599,944 I424T probably damaging Het
Tcaf1 T G 6: 42,679,287 T252P probably benign Het
Thbs1 A G 2: 118,113,132 D77G probably damaging Het
Trim21 T C 7: 102,559,468 E348G probably benign Het
Trpm3 A G 19: 22,918,676 D959G probably benign Het
Ttc24 A T 3: 88,072,726 C182* probably null Het
Tti1 T C 2: 158,008,594 T242A probably benign Het
Ube3b G T 5: 114,388,739 C100F probably damaging Het
Vmn1r26 T A 6: 58,008,455 T250S possibly damaging Het
Vnn1 A G 10: 23,904,628 T505A probably benign Het
Vps13a C A 19: 16,664,789 W2158L probably damaging Het
Vwa1 A T 4: 155,772,888 V151E probably damaging Het
Zfp14 A G 7: 30,043,536 S46P probably damaging Het
Zfp773 C A 7: 7,132,571 C342F probably benign Het
Zscan12 T A 13: 21,363,821 S58T possibly damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCGATCTAGACTTCTGCATAAGGG -3'
(R):5'- CCACCCATGTCAAGGTCATTG -3'

Sequencing Primer
(F):5'- CTAGACTTCTGCATAAGGGTAAGTTC -3'
(R):5'- AAGGTCATTGTTTCCCATGAGC -3'
Posted On 2021-04-30