Incidental Mutation 'R8784:Ints2'
ID 670508
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86210681-86257575 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86222137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 852 (I852F)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: I852F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: I852F

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: I852F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: I852F

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,002,601 M614K probably benign Het
Adamts7 G T 9: 90,193,865 V1217L probably null Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Atf7ip A G 6: 136,599,650 D1017G probably damaging Het
Atg2b A C 12: 105,639,241 D1488E probably damaging Het
Atxn2 A G 5: 121,795,028 T805A probably benign Het
Azi2 A T 9: 118,055,892 H223L probably benign Het
Banp T A 8: 122,001,113 S349T probably damaging Het
Bicra A T 7: 15,971,950 I1522N probably damaging Het
Brca2 A T 5: 150,548,661 R2342* probably null Het
C6 T C 15: 4,793,140 C623R probably damaging Het
Cc2d2a T C 5: 43,703,303 Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,912,386 C115Y probably benign Het
Chrm4 T A 2: 91,927,688 M147K probably benign Het
Cit A T 5: 115,846,383 K5* probably null Het
Ciz1 T A 2: 32,370,250 S231T probably benign Het
Crebrf A G 17: 26,742,546 I206V probably benign Het
Cyc1 T C 15: 76,343,663 S34P probably benign Het
Dnah5 A G 15: 28,387,951 I3185M probably benign Het
Dtnbp1 T C 13: 44,922,226 D347G unknown Het
Dzip3 A T 16: 48,931,265 V767E probably damaging Het
E330021D16Rik G A 6: 136,401,731 Q34* probably null Het
Fam57a T C 11: 76,208,115 F237S probably damaging Het
Gdf3 A T 6: 122,606,320 C363S probably damaging Het
Glb1l T C 1: 75,200,331 K487R probably damaging Het
Gm9747 T C 1: 82,234,281 V67A unknown Het
Hoxb2 A G 11: 96,351,910 T34A possibly damaging Het
Ifnk C T 4: 35,152,383 R104C probably damaging Het
Igfbp1 A T 11: 7,201,952 I252F probably damaging Het
Ighv1-74 T C 12: 115,802,860 T47A probably benign Het
Igkv4-62 A T 6: 69,399,962 W68R probably damaging Het
Il23r A G 6: 67,466,417 I234T probably damaging Het
Jhy T G 9: 40,960,886 H109P probably benign Het
Katna1 T A 10: 7,738,815 V29D possibly damaging Het
Kcng4 T A 8: 119,626,231 E313D probably benign Het
Klf14 T A 6: 30,958,114 H195L probably damaging Het
Lama3 A G 18: 12,421,155 N472S probably benign Het
Layn A T 9: 51,059,481 V254E possibly damaging Het
Lrba A T 3: 86,375,928 S1850C probably damaging Het
Map1s A G 8: 70,906,265 I2V unknown Het
Map3k12 T A 15: 102,505,362 Q58L possibly damaging Het
Minpp1 T C 19: 32,513,996 V358A probably benign Het
Mymk C G 2: 27,071,935 K27N possibly damaging Het
Nek8 T C 11: 78,172,549 K130E probably damaging Het
Ngef T A 1: 87,477,571 S706C probably damaging Het
Nsun6 G A 2: 14,996,495 Q417* probably null Het
Ntsr2 G T 12: 16,656,851 Q293H probably damaging Het
Ocln T A 13: 100,539,542 I148F probably damaging Het
Olfr101 A G 17: 37,299,810 I204T probably benign Het
Olfr1180 A T 2: 88,411,747 Y304N probably benign Het
Olfr948 T A 9: 39,318,693 Q307L probably benign Het
Pank3 T G 11: 35,781,585 F272V probably damaging Het
Piezo1 A T 8: 122,496,589 probably benign Het
Plppr4 G A 3: 117,322,541 R556* probably null Het
Polr1a G T 6: 71,950,628 R821L probably benign Het
Ppp1r36 C T 12: 76,439,193 T375I probably benign Het
Ptprj T A 2: 90,460,512 I628F possibly damaging Het
Puf60 C A 15: 76,077,676 V29F unknown Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf1 A G 9: 107,557,842 S179G probably benign Het
Rbm6 A G 9: 107,788,138 S772P possibly damaging Het
Rnf103 T G 6: 71,509,998 S538A probably benign Het
Scoc C A 8: 83,437,616 V58L probably benign Het
Secisbp2l G A 2: 125,760,343 Q366* probably null Het
Slc16a14 T C 1: 84,913,063 T174A probably benign Het
Slc25a22 A C 7: 141,431,107 *324G probably null Het
Smarca2 C T 19: 26,776,158 T197I probably benign Het
Speg T C 1: 75,405,149 probably benign Het
Srgap2 T A 1: 131,295,474 N858I unknown Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tbc1d22b T C 17: 29,599,944 I424T probably damaging Het
Tcaf1 T G 6: 42,679,287 T252P probably benign Het
Thbs1 A G 2: 118,113,132 D77G probably damaging Het
Trim21 T C 7: 102,559,468 E348G probably benign Het
Trpm3 A G 19: 22,918,676 D959G probably benign Het
Ttc24 A T 3: 88,072,726 C182* probably null Het
Tti1 T C 2: 158,008,594 T242A probably benign Het
Ube3b G T 5: 114,388,739 C100F probably damaging Het
Vmn1r26 T A 6: 58,008,455 T250S possibly damaging Het
Vnn1 A G 10: 23,904,628 T505A probably benign Het
Vps13a C A 19: 16,664,789 W2158L probably damaging Het
Vwa1 A T 4: 155,772,888 V151E probably damaging Het
Zfp14 A G 7: 30,043,536 S46P probably damaging Het
Zfp773 C A 7: 7,132,571 C342F probably benign Het
Zscan12 T A 13: 21,363,821 S58T possibly damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7804:Ints2 UTSW 11 86212663 missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7918:Ints2 UTSW 11 86222217 missense probably damaging 1.00
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8189:Ints2 UTSW 11 86215570 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86225115 nonsense probably null
R8942:Ints2 UTSW 11 86212894 missense probably benign 0.00
R9037:Ints2 UTSW 11 86215704 missense probably benign
R9154:Ints2 UTSW 11 86234698 missense probably damaging 1.00
R9397:Ints2 UTSW 11 86244485 missense probably benign 0.01
R9412:Ints2 UTSW 11 86226763 missense probably damaging 0.99
R9472:Ints2 UTSW 11 86242998 missense
R9476:Ints2 UTSW 11 86244509 missense probably benign
R9510:Ints2 UTSW 11 86244509 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCTCAGTGGGTTAGAGC -3'
(R):5'- GCCTGAAATACATGAGAGCCT -3'

Sequencing Primer
(F):5'- TGGTGGCTCACAACCATC -3'
(R):5'- GGTTAATGCACTCCAACC -3'
Posted On 2021-04-30