Incidental Mutation 'R0094:Sirpb1c'
ID67055
Institutional Source Beutler Lab
Gene Symbol Sirpb1c
Ensembl Gene ENSMUSG00000074677
Gene Namesignal-regulatory protein beta 1C
Synonyms
MMRRC Submission 038380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0094 (G1)
Quality Score87
Status Not validated
Chromosome3
Chromosomal Location15795145-15848528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15838758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 94 (T94K)
Ref Sequence ENSEMBL: ENSMUSP00000061216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050623] [ENSMUST00000108349] [ENSMUST00000108350] [ENSMUST00000108352] [ENSMUST00000108354]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050623
AA Change: T94K

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061216
Gene: ENSMUSG00000074677
AA Change: T94K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108349
AA Change: T92K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103986
Gene: ENSMUSG00000074677
AA Change: T92K

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 35 141 3.51e-8 SMART
IGc1 161 234 4.07e-4 SMART
IGc1 264 337 2.21e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108350
AA Change: T94K

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103987
Gene: ENSMUSG00000074677
AA Change: T94K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108352
AA Change: T94K

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103989
Gene: ENSMUSG00000074677
AA Change: T94K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108354
AA Change: T94K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677
AA Change: T94K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124067
Predicted Effect probably benign
Transcript: ENSMUST00000148194
SMART Domains Protein: ENSMUSP00000120527
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
IGc1 32 105 4.07e-4 SMART
IGc1 135 208 2.21e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191802
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,306,886 T185S possibly damaging Het
Amotl1 A G 9: 14,575,387 S441P probably benign Het
Ap5z1 G A 5: 142,476,812 V626M probably benign Het
Cacna2d3 C T 14: 29,170,503 probably null Het
Cfap77 A T 2: 28,984,434 V128D probably damaging Het
Colgalt1 T C 8: 71,623,158 V483A probably damaging Het
Dcdc2b T C 4: 129,610,311 probably null Het
Dsg2 A T 18: 20,591,853 T439S probably benign Het
Dtx1 A G 5: 120,682,624 Y455H probably damaging Het
Frmpd1 C A 4: 45,284,899 S1240* probably null Het
Gypa T A 8: 80,500,931 H69Q unknown Het
Mfap5 G A 6: 122,525,992 V54I probably damaging Het
Mroh7 C T 4: 106,703,184 G641E probably damaging Het
Mvd C T 8: 122,439,703 R65H probably benign Het
Olfr293 A G 7: 86,664,294 S211G probably benign Het
Pigs T A 11: 78,340,038 N370K probably damaging Het
Pkd1 A G 17: 24,581,276 T3004A possibly damaging Het
Pkhd1 T A 1: 20,209,246 R2949S probably damaging Het
Ptpro T C 6: 137,386,352 Y495H probably benign Het
Rfc4 G T 16: 23,115,428 Q208K probably benign Het
Rpa2 T C 4: 132,770,582 S52P probably damaging Het
Sis A T 3: 72,921,437 N1136K probably damaging Het
Spp2 T A 1: 88,420,680 probably null Het
Ubr3 C T 2: 69,951,362 T628I probably damaging Het
Vmn1r213 A G 13: 23,011,649 H134R probably damaging Het
Vmn2r59 T C 7: 42,012,298 R698G probably benign Het
Other mutations in Sirpb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Sirpb1c APN 3 15838773 missense probably benign 0.06
R0356:Sirpb1c UTSW 3 15833145 missense possibly damaging 0.95
R0442:Sirpb1c UTSW 3 15802546 missense probably benign 0.09
R3731:Sirpb1c UTSW 3 15833123 missense probably damaging 1.00
R4812:Sirpb1c UTSW 3 15833222 missense probably damaging 0.99
R5802:Sirpb1c UTSW 3 15832076 missense probably benign 0.00
R6315:Sirpb1c UTSW 3 15832306 missense possibly damaging 0.71
R7107:Sirpb1c UTSW 3 15838777 missense possibly damaging 0.91
R7148:Sirpb1c UTSW 3 15833059 nonsense probably null
R7349:Sirpb1c UTSW 3 15832146 critical splice donor site probably null
R7356:Sirpb1c UTSW 3 15832133 missense probably benign
R7359:Sirpb1c UTSW 3 15833225 missense probably benign 0.02
R7466:Sirpb1c UTSW 3 15832266 missense probably damaging 1.00
R7629:Sirpb1c UTSW 3 15848395 missense possibly damaging 0.86
R7720:Sirpb1c UTSW 3 15832072 missense probably benign 0.00
R7726:Sirpb1c UTSW 3 15848386 missense possibly damaging 0.92
R7853:Sirpb1c UTSW 3 15832992 missense probably damaging 1.00
R7886:Sirpb1c UTSW 3 15832202 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGGAAACCTCTAGCACATAGCACG -3'
(R):5'- GAGAGCTGAAGGTGATCCAACCTG -3'

Sequencing Primer
(F):5'- CAGAGTATTAGAGCCTTCGGACC -3'
(R):5'- CTGAAGGTGATCCAACCTGTTAAATC -3'
Posted On2013-08-20