Incidental Mutation 'R8785:Cpa1'
ID 670554
Institutional Source Beutler Lab
Gene Symbol Cpa1
Ensembl Gene ENSMUSG00000054446
Gene Name carboxypeptidase A1, pancreatic
Synonyms 0910001L12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 30639218-30645363 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30645252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 409 (T409I)
Ref Sequence ENSEMBL: ENSMUSP00000031806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031806]
AlphaFold Q7TPZ8
Predicted Effect probably benign
Transcript: ENSMUST00000031806
AA Change: T409I

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031806
Gene: ENSMUSG00000054446
AA Change: T409I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Propep_M14 26 100 1.6e-24 PFAM
Zn_pept 122 402 1.09e-132 SMART
Meta Mutation Damage Score 0.1733 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase A, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme. This gene is expressed in pancreas, the encoded protein is a major component of digestive enzymes secreted by pancreas and plays an important role in the process of digestion. This gene is located in a cluster of related carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-in allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,890 M391K possibly damaging Het
2410089E03Rik T C 15: 8,174,760 F39S probably benign Het
9530053A07Rik C T 7: 28,154,707 H1699Y probably damaging Het
Abra T A 15: 41,866,260 D248V probably damaging Het
Acsm1 A T 7: 119,662,230 T557S probably benign Het
Actn2 C A 13: 12,277,431 A648S probably benign Het
Adam18 A T 8: 24,650,895 I280N probably damaging Het
Adgb T A 10: 10,357,966 I1256F probably damaging Het
Afap1 A T 5: 35,950,960 K217* probably null Het
Amigo1 T C 3: 108,187,350 V55A probably benign Het
Ank2 G A 3: 126,997,921 R799W probably damaging Het
Atf7 T C 15: 102,546,539 T265A probably benign Het
Atf7ip A T 6: 136,587,164 T794S probably damaging Het
Atp13a3 A G 16: 30,350,982 I426T probably benign Het
Atp5a1 T A 18: 77,779,223 D265E probably benign Het
Cct6b A G 11: 82,741,331 L277P probably damaging Het
Cdh23 T A 10: 60,311,335 T2745S probably damaging Het
Cfap44 C T 16: 44,455,532 T1385M probably damaging Het
Csmd3 G A 15: 48,314,086 A352V probably benign Het
Cyp11b2 C T 15: 74,852,112 A341T probably benign Het
Ddx43 A T 9: 78,421,759 E630V possibly damaging Het
Dusp3 C G 11: 101,981,734 E11Q probably benign Het
Eme1 C A 11: 94,650,621 G125V probably benign Het
Fam126a A G 5: 23,964,906 S482P probably damaging Het
Fbxo7 C T 10: 86,024,546 P85S probably benign Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gldc A T 19: 30,115,234 C762S probably damaging Het
Gm15448 G A 7: 3,816,929 S663L unknown Het
Gnmt T G 17: 46,727,387 D71A probably damaging Het
Golgb1 T A 16: 36,919,744 V2856E probably damaging Het
Gpr160 T C 3: 30,896,774 S332P probably damaging Het
Gria4 A C 9: 4,456,106 N731K probably damaging Het
Gria4 A G 9: 4,795,189 I29T possibly damaging Het
Grk1 C T 8: 13,408,058 probably benign Het
Ints11 G A 4: 155,869,708 V6I probably benign Het
Irgq C A 7: 24,533,580 T282K probably damaging Het
Itih2 T A 2: 10,097,969 T785S probably benign Het
Lrrc37a G A 11: 103,456,416 T3151I probably damaging Het
Macf1 T A 4: 123,448,260 probably null Het
Mcm6 T C 1: 128,334,798 N725S probably benign Het
Mmp14 T A 14: 54,436,775 F181I probably damaging Het
Ms4a6d A G 19: 11,593,036 probably benign Het
Myf5 A G 10: 107,485,687 M82T probably benign Het
Neb A G 2: 52,169,890 S6330P probably damaging Het
Nlrp2 T A 7: 5,327,549 H616L probably damaging Het
Noxred1 T C 12: 87,224,166 N227S probably benign Het
Nup214 T A 2: 32,034,453 F1665I probably damaging Het
Olfr1253 T C 2: 89,752,954 probably benign Het
Olfr187 T C 16: 59,036,167 D190G probably damaging Het
Olfr822 A T 10: 130,074,616 I69F probably benign Het
Pgk2 A G 17: 40,207,886 V217A probably damaging Het
Polr3a T C 14: 24,452,315 T1257A probably benign Het
Pwwp2b A T 7: 139,256,170 H509L possibly damaging Het
Qser1 C T 2: 104,787,753 V815I probably damaging Het
Rif1 T G 2: 52,110,481 S1316A probably benign Het
Rnf121 T A 7: 102,029,126 K171N probably damaging Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Serac1 A T 17: 6,044,202 I626N probably damaging Het
Setx T C 2: 29,145,263 C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Shc4 A G 2: 125,649,144 probably null Het
Slc16a8 C T 15: 79,252,313 V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slit3 A G 11: 35,670,141 H971R probably damaging Het
Sp100 T A 1: 85,699,751 probably benign Het
Stfa1 C A 16: 36,285,253 Y115* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Timm44 A T 8: 4,270,019 S50T probably benign Het
Trim25 G A 11: 89,013,514 V378I probably benign Het
Ttn T C 2: 76,895,560 S6111G unknown Het
Urb1 C A 16: 90,803,423 M157I probably benign Het
Zbtb4 C A 11: 69,778,163 Q571K possibly damaging Het
Zfp985 A T 4: 147,583,623 H316L probably damaging Het
Zfp990 A T 4: 145,537,676 I415L probably benign Het
Other mutations in Cpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cpa1 APN 6 30642969 missense probably benign 0.05
IGL01288:Cpa1 APN 6 30640583 missense probably damaging 1.00
IGL01402:Cpa1 APN 6 30645276 missense possibly damaging 0.83
IGL01504:Cpa1 APN 6 30640721 missense probably benign 0.00
IGL01980:Cpa1 APN 6 30641582 missense possibly damaging 0.78
IGL02885:Cpa1 APN 6 30645170 missense probably damaging 1.00
P0026:Cpa1 UTSW 6 30640906 missense probably damaging 0.96
PIT4544001:Cpa1 UTSW 6 30641858 missense probably benign 0.00
R0398:Cpa1 UTSW 6 30645251 missense probably benign 0.00
R0403:Cpa1 UTSW 6 30641857 missense probably benign 0.15
R1117:Cpa1 UTSW 6 30645261 missense probably benign 0.16
R1548:Cpa1 UTSW 6 30642335 missense probably damaging 1.00
R1631:Cpa1 UTSW 6 30640924 missense probably damaging 1.00
R1780:Cpa1 UTSW 6 30643008 missense probably damaging 1.00
R2202:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2203:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2204:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2205:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R4838:Cpa1 UTSW 6 30639516 missense possibly damaging 0.80
R5497:Cpa1 UTSW 6 30640730 missense probably benign 0.42
R6306:Cpa1 UTSW 6 30640954 missense probably damaging 1.00
R7062:Cpa1 UTSW 6 30640677 missense probably benign 0.03
R7085:Cpa1 UTSW 6 30643620 missense probably benign 0.10
R7564:Cpa1 UTSW 6 30641768 missense probably damaging 0.97
R8743:Cpa1 UTSW 6 30642993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGTGTTAAGTCAGTCCATG -3'
(R):5'- ACCCTCGGGAGCTTAATCAC -3'

Sequencing Primer
(F):5'- AGATATTTCTAGTGATCAACCCTTCC -3'
(R):5'- CGGGAGCTTAATCACTACTGC -3'
Posted On 2021-04-30