Incidental Mutation 'R8785:Nlrp2'
ID 670558
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Pan1, Nbs1, E330007A02Rik, PYPAF2, Nalp2
MMRRC Submission 068722-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5301546-5354034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5330548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 616 (H616L)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: H616L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: H616L

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,729,656 (GRCm39) D248V probably damaging Het
Acsm1 A T 7: 119,261,453 (GRCm39) T557S probably benign Het
Actn2 C A 13: 12,292,317 (GRCm39) A648S probably benign Het
Adam18 A T 8: 25,140,911 (GRCm39) I280N probably damaging Het
Adgb T A 10: 10,233,710 (GRCm39) I1256F probably damaging Het
Afap1 A T 5: 36,108,304 (GRCm39) K217* probably null Het
Amigo1 T C 3: 108,094,666 (GRCm39) V55A probably benign Het
Ank2 G A 3: 126,791,570 (GRCm39) R799W probably damaging Het
Atf7 T C 15: 102,454,974 (GRCm39) T265A probably benign Het
Atf7ip A T 6: 136,564,162 (GRCm39) T794S probably damaging Het
Atp13a3 A G 16: 30,169,800 (GRCm39) I426T probably benign Het
Atp5f1a T A 18: 77,866,923 (GRCm39) D265E probably benign Het
Cct6b A G 11: 82,632,157 (GRCm39) L277P probably damaging Het
Cdh23 T A 10: 60,147,114 (GRCm39) T2745S probably damaging Het
Cfap44 C T 16: 44,275,895 (GRCm39) T1385M probably damaging Het
Cpa1 C T 6: 30,645,251 (GRCm39) T409I probably benign Het
Cplane1 T C 15: 8,204,244 (GRCm39) F39S probably benign Het
Csmd3 G A 15: 48,177,482 (GRCm39) A352V probably benign Het
Cyp11b2 C T 15: 74,723,961 (GRCm39) A341T probably benign Het
Ddx43 A T 9: 78,329,041 (GRCm39) E630V possibly damaging Het
Dusp3 C G 11: 101,872,560 (GRCm39) E11Q probably benign Het
Eme1 C A 11: 94,541,447 (GRCm39) G125V probably benign Het
Fbxo7 C T 10: 85,860,410 (GRCm39) P85S probably benign Het
Fcgbpl1 C T 7: 27,854,132 (GRCm39) H1699Y probably damaging Het
Gcc2 T A 10: 58,107,086 (GRCm39) I774K probably benign Het
Gldc A T 19: 30,092,634 (GRCm39) C762S probably damaging Het
Gnmt T G 17: 47,038,313 (GRCm39) D71A probably damaging Het
Golgb1 T A 16: 36,740,106 (GRCm39) V2856E probably damaging Het
Gpr160 T C 3: 30,950,923 (GRCm39) S332P probably damaging Het
Gria4 A C 9: 4,456,106 (GRCm39) N731K probably damaging Het
Gria4 A G 9: 4,795,189 (GRCm39) I29T possibly damaging Het
Grk1 C T 8: 13,458,058 (GRCm39) probably benign Het
Hycc1 A G 5: 24,169,904 (GRCm39) S482P probably damaging Het
Ints11 G A 4: 155,954,165 (GRCm39) V6I probably benign Het
Irgq C A 7: 24,233,005 (GRCm39) T282K probably damaging Het
Itih2 T A 2: 10,102,780 (GRCm39) T785S probably benign Het
Lrrc37a G A 11: 103,347,242 (GRCm39) T3151I probably damaging Het
Macf1 T A 4: 123,342,053 (GRCm39) probably null Het
Mcm6 T C 1: 128,262,535 (GRCm39) N725S probably benign Het
Mmp14 T A 14: 54,674,232 (GRCm39) F181I probably damaging Het
Ms4a6d A G 19: 11,570,400 (GRCm39) probably benign Het
Myf5 A G 10: 107,321,548 (GRCm39) M82T probably benign Het
Neb A G 2: 52,059,902 (GRCm39) S6330P probably damaging Het
Noxred1 T C 12: 87,270,940 (GRCm39) N227S probably benign Het
Nup214 T A 2: 31,924,465 (GRCm39) F1665I probably damaging Het
Nup50l A T 6: 96,141,871 (GRCm39) M391K possibly damaging Het
Or4a80 T C 2: 89,583,298 (GRCm39) probably benign Het
Or5h19 T C 16: 58,856,530 (GRCm39) D190G probably damaging Het
Or6c69c A T 10: 129,910,485 (GRCm39) I69F probably benign Het
Pgk2 A G 17: 40,518,777 (GRCm39) V217A probably damaging Het
Pira13 G A 7: 3,819,928 (GRCm39) S663L unknown Het
Polr3a T C 14: 24,502,383 (GRCm39) T1257A probably benign Het
Pwwp2b A T 7: 138,836,086 (GRCm39) H509L possibly damaging Het
Qser1 C T 2: 104,618,098 (GRCm39) V815I probably damaging Het
Rif1 T G 2: 52,000,493 (GRCm39) S1316A probably benign Het
Rnf121 T A 7: 101,678,333 (GRCm39) K171N probably damaging Het
Samd9l G A 6: 3,377,064 (GRCm39) L66F probably damaging Het
Serac1 A T 17: 6,094,477 (GRCm39) I626N probably damaging Het
Setx T C 2: 29,035,275 (GRCm39) C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,640,271 (GRCm39) probably benign Het
Shc4 A G 2: 125,491,064 (GRCm39) probably null Het
Slc16a8 C T 15: 79,136,513 (GRCm39) V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slit3 A G 11: 35,560,968 (GRCm39) H971R probably damaging Het
Sp100 T A 1: 85,627,472 (GRCm39) probably benign Het
Stfa1 C A 16: 36,105,615 (GRCm39) Y115* probably null Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Timm44 A T 8: 4,320,019 (GRCm39) S50T probably benign Het
Trim25 G A 11: 88,904,340 (GRCm39) V378I probably benign Het
Ttn T C 2: 76,725,904 (GRCm39) S6111G unknown Het
Urb1 C A 16: 90,600,311 (GRCm39) M157I probably benign Het
Zbtb4 C A 11: 69,668,989 (GRCm39) Q571K possibly damaging Het
Zfp985 A T 4: 147,668,080 (GRCm39) H316L probably damaging Het
Zfp990 A T 4: 145,264,246 (GRCm39) I415L probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5,340,547 (GRCm39) missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5,331,251 (GRCm39) missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5,322,238 (GRCm39) missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5,320,491 (GRCm39) missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5,340,769 (GRCm39) missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5,331,034 (GRCm39) missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5,330,822 (GRCm39) missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5,331,809 (GRCm39) missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5,338,566 (GRCm39) critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5,330,551 (GRCm39) nonsense probably null
IGL02803:Nlrp2 APN 7 5,331,317 (GRCm39) missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5,304,024 (GRCm39) missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5,320,482 (GRCm39) missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5,325,333 (GRCm39) unclassified probably benign
R0079:Nlrp2 UTSW 7 5,330,729 (GRCm39) missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5,325,417 (GRCm39) missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5,311,769 (GRCm39) missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5,331,328 (GRCm39) missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5,331,108 (GRCm39) missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5,331,544 (GRCm39) missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5,320,629 (GRCm39) missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5,322,221 (GRCm39) missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5,331,430 (GRCm39) missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5,330,490 (GRCm39) missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5,332,014 (GRCm39) splice site probably benign
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5,311,724 (GRCm39) missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5,330,715 (GRCm39) nonsense probably null
R1942:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5,328,005 (GRCm39) missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5,328,041 (GRCm39) missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5,322,237 (GRCm39) missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5,338,597 (GRCm39) missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5,331,128 (GRCm39) missense probably benign
R2334:Nlrp2 UTSW 7 5,340,534 (GRCm39) missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5,330,747 (GRCm39) missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5,322,286 (GRCm39) missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5,330,551 (GRCm39) nonsense probably null
R4021:Nlrp2 UTSW 7 5,328,011 (GRCm39) missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5,328,055 (GRCm39) missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5,322,188 (GRCm39) missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5,331,023 (GRCm39) missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5,331,950 (GRCm39) missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5,331,076 (GRCm39) missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5,330,614 (GRCm39) missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5,328,007 (GRCm39) missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5,331,118 (GRCm39) missense probably benign
R5390:Nlrp2 UTSW 7 5,303,908 (GRCm39) missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5,325,380 (GRCm39) missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5,327,902 (GRCm39) splice site probably null
R6173:Nlrp2 UTSW 7 5,340,808 (GRCm39) missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5,320,554 (GRCm39) missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5,340,760 (GRCm39) missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5,303,925 (GRCm39) missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5,328,040 (GRCm39) nonsense probably null
R6814:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5,331,228 (GRCm39) nonsense probably null
R7028:Nlrp2 UTSW 7 5,331,571 (GRCm39) missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5,331,616 (GRCm39) missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5,320,533 (GRCm39) missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5,311,644 (GRCm39) missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5,330,627 (GRCm39) missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5,320,468 (GRCm39) critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5,322,167 (GRCm39) missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5,331,527 (GRCm39) missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5,330,650 (GRCm39) missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5,320,494 (GRCm39) missense probably benign 0.40
R8798:Nlrp2 UTSW 7 5,330,887 (GRCm39) missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5,327,978 (GRCm39) missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5,325,457 (GRCm39) missense probably null 0.00
R9038:Nlrp2 UTSW 7 5,330,478 (GRCm39) missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5,330,572 (GRCm39) missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5,304,052 (GRCm39) missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5,322,215 (GRCm39) missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5,330,641 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATAGAGAATGAGAGACTTCAGCCTC -3'
(R):5'- GCTGCCAAATATCAACTGAGG -3'

Sequencing Primer
(F):5'- TATTAAATACACAAGGGATGAGTTGG -3'
(R):5'- GCTGCCAAATATCAACTGAGGTCAAG -3'
Posted On 2021-04-30