Incidental Mutation 'R8785:Nlrp2'
ID 670558
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5298547-5351035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5327549 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 616 (H616L)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: H616L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: H616L

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,890 M391K possibly damaging Het
2410089E03Rik T C 15: 8,174,760 F39S probably benign Het
9530053A07Rik C T 7: 28,154,707 H1699Y probably damaging Het
Abra T A 15: 41,866,260 D248V probably damaging Het
Acsm1 A T 7: 119,662,230 T557S probably benign Het
Actn2 C A 13: 12,277,431 A648S probably benign Het
Adam18 A T 8: 24,650,895 I280N probably damaging Het
Adgb T A 10: 10,357,966 I1256F probably damaging Het
Afap1 A T 5: 35,950,960 K217* probably null Het
Amigo1 T C 3: 108,187,350 V55A probably benign Het
Ank2 G A 3: 126,997,921 R799W probably damaging Het
Atf7 T C 15: 102,546,539 T265A probably benign Het
Atf7ip A T 6: 136,587,164 T794S probably damaging Het
Atp13a3 A G 16: 30,350,982 I426T probably benign Het
Atp5a1 T A 18: 77,779,223 D265E probably benign Het
Cct6b A G 11: 82,741,331 L277P probably damaging Het
Cdh23 T A 10: 60,311,335 T2745S probably damaging Het
Cfap44 C T 16: 44,455,532 T1385M probably damaging Het
Cpa1 C T 6: 30,645,252 T409I probably benign Het
Csmd3 G A 15: 48,314,086 A352V probably benign Het
Cyp11b2 C T 15: 74,852,112 A341T probably benign Het
Ddx43 A T 9: 78,421,759 E630V possibly damaging Het
Dusp3 C G 11: 101,981,734 E11Q probably benign Het
Eme1 C A 11: 94,650,621 G125V probably benign Het
Fam126a A G 5: 23,964,906 S482P probably damaging Het
Fbxo7 C T 10: 86,024,546 P85S probably benign Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gldc A T 19: 30,115,234 C762S probably damaging Het
Gm15448 G A 7: 3,816,929 S663L unknown Het
Gnmt T G 17: 46,727,387 D71A probably damaging Het
Golgb1 T A 16: 36,919,744 V2856E probably damaging Het
Gpr160 T C 3: 30,896,774 S332P probably damaging Het
Gria4 A C 9: 4,456,106 N731K probably damaging Het
Gria4 A G 9: 4,795,189 I29T possibly damaging Het
Grk1 C T 8: 13,408,058 probably benign Het
Ints11 G A 4: 155,869,708 V6I probably benign Het
Irgq C A 7: 24,533,580 T282K probably damaging Het
Itih2 T A 2: 10,097,969 T785S probably benign Het
Lrrc37a G A 11: 103,456,416 T3151I probably damaging Het
Macf1 T A 4: 123,448,260 probably null Het
Mcm6 T C 1: 128,334,798 N725S probably benign Het
Mmp14 T A 14: 54,436,775 F181I probably damaging Het
Ms4a6d A G 19: 11,593,036 probably benign Het
Myf5 A G 10: 107,485,687 M82T probably benign Het
Neb A G 2: 52,169,890 S6330P probably damaging Het
Noxred1 T C 12: 87,224,166 N227S probably benign Het
Nup214 T A 2: 32,034,453 F1665I probably damaging Het
Olfr1253 T C 2: 89,752,954 probably benign Het
Olfr187 T C 16: 59,036,167 D190G probably damaging Het
Olfr822 A T 10: 130,074,616 I69F probably benign Het
Pgk2 A G 17: 40,207,886 V217A probably damaging Het
Polr3a T C 14: 24,452,315 T1257A probably benign Het
Pwwp2b A T 7: 139,256,170 H509L possibly damaging Het
Qser1 C T 2: 104,787,753 V815I probably damaging Het
Rif1 T G 2: 52,110,481 S1316A probably benign Het
Rnf121 T A 7: 102,029,126 K171N probably damaging Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Serac1 A T 17: 6,044,202 I626N probably damaging Het
Setx T C 2: 29,145,263 C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Shc4 A G 2: 125,649,144 probably null Het
Slc16a8 C T 15: 79,252,313 V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slit3 A G 11: 35,670,141 H971R probably damaging Het
Sp100 T A 1: 85,699,751 probably benign Het
Stfa1 C A 16: 36,285,253 Y115* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Timm44 A T 8: 4,270,019 S50T probably benign Het
Trim25 G A 11: 89,013,514 V378I probably benign Het
Ttn T C 2: 76,895,560 S6111G unknown Het
Urb1 C A 16: 90,803,423 M157I probably benign Het
Zbtb4 C A 11: 69,778,163 Q571K possibly damaging Het
Zfp985 A T 4: 147,583,623 H316L probably damaging Het
Zfp990 A T 4: 145,537,676 I415L probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
R8798:Nlrp2 UTSW 7 5327888 missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5324979 missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5322458 missense probably null 0.00
R9038:Nlrp2 UTSW 7 5327479 missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5327573 missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5301053 missense possibly damaging 0.81
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATAGAGAATGAGAGACTTCAGCCTC -3'
(R):5'- GCTGCCAAATATCAACTGAGG -3'

Sequencing Primer
(F):5'- TATTAAATACACAAGGGATGAGTTGG -3'
(R):5'- GCTGCCAAATATCAACTGAGGTCAAG -3'
Posted On 2021-04-30