Incidental Mutation 'R8785:Fcgbpl1'
ID 670560
Institutional Source Beutler Lab
Gene Symbol Fcgbpl1
Ensembl Gene ENSMUSG00000078776
Gene Name Fc fragment of IgG binding protein like 1
Synonyms 9530053A07Rik
MMRRC Submission 068722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 27828891-27864236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27854132 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1699 (H1699Y)
Ref Sequence ENSEMBL: ENSMUSP00000056479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: H1699Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: H1699Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: H1699Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: H1699Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,729,656 (GRCm39) D248V probably damaging Het
Acsm1 A T 7: 119,261,453 (GRCm39) T557S probably benign Het
Actn2 C A 13: 12,292,317 (GRCm39) A648S probably benign Het
Adam18 A T 8: 25,140,911 (GRCm39) I280N probably damaging Het
Adgb T A 10: 10,233,710 (GRCm39) I1256F probably damaging Het
Afap1 A T 5: 36,108,304 (GRCm39) K217* probably null Het
Amigo1 T C 3: 108,094,666 (GRCm39) V55A probably benign Het
Ank2 G A 3: 126,791,570 (GRCm39) R799W probably damaging Het
Atf7 T C 15: 102,454,974 (GRCm39) T265A probably benign Het
Atf7ip A T 6: 136,564,162 (GRCm39) T794S probably damaging Het
Atp13a3 A G 16: 30,169,800 (GRCm39) I426T probably benign Het
Atp5f1a T A 18: 77,866,923 (GRCm39) D265E probably benign Het
Cct6b A G 11: 82,632,157 (GRCm39) L277P probably damaging Het
Cdh23 T A 10: 60,147,114 (GRCm39) T2745S probably damaging Het
Cfap44 C T 16: 44,275,895 (GRCm39) T1385M probably damaging Het
Cpa1 C T 6: 30,645,251 (GRCm39) T409I probably benign Het
Cplane1 T C 15: 8,204,244 (GRCm39) F39S probably benign Het
Csmd3 G A 15: 48,177,482 (GRCm39) A352V probably benign Het
Cyp11b2 C T 15: 74,723,961 (GRCm39) A341T probably benign Het
Ddx43 A T 9: 78,329,041 (GRCm39) E630V possibly damaging Het
Dusp3 C G 11: 101,872,560 (GRCm39) E11Q probably benign Het
Eme1 C A 11: 94,541,447 (GRCm39) G125V probably benign Het
Fbxo7 C T 10: 85,860,410 (GRCm39) P85S probably benign Het
Gcc2 T A 10: 58,107,086 (GRCm39) I774K probably benign Het
Gldc A T 19: 30,092,634 (GRCm39) C762S probably damaging Het
Gnmt T G 17: 47,038,313 (GRCm39) D71A probably damaging Het
Golgb1 T A 16: 36,740,106 (GRCm39) V2856E probably damaging Het
Gpr160 T C 3: 30,950,923 (GRCm39) S332P probably damaging Het
Gria4 A C 9: 4,456,106 (GRCm39) N731K probably damaging Het
Gria4 A G 9: 4,795,189 (GRCm39) I29T possibly damaging Het
Grk1 C T 8: 13,458,058 (GRCm39) probably benign Het
Hycc1 A G 5: 24,169,904 (GRCm39) S482P probably damaging Het
Ints11 G A 4: 155,954,165 (GRCm39) V6I probably benign Het
Irgq C A 7: 24,233,005 (GRCm39) T282K probably damaging Het
Itih2 T A 2: 10,102,780 (GRCm39) T785S probably benign Het
Lrrc37a G A 11: 103,347,242 (GRCm39) T3151I probably damaging Het
Macf1 T A 4: 123,342,053 (GRCm39) probably null Het
Mcm6 T C 1: 128,262,535 (GRCm39) N725S probably benign Het
Mmp14 T A 14: 54,674,232 (GRCm39) F181I probably damaging Het
Ms4a6d A G 19: 11,570,400 (GRCm39) probably benign Het
Myf5 A G 10: 107,321,548 (GRCm39) M82T probably benign Het
Neb A G 2: 52,059,902 (GRCm39) S6330P probably damaging Het
Nlrp2 T A 7: 5,330,548 (GRCm39) H616L probably damaging Het
Noxred1 T C 12: 87,270,940 (GRCm39) N227S probably benign Het
Nup214 T A 2: 31,924,465 (GRCm39) F1665I probably damaging Het
Nup50l A T 6: 96,141,871 (GRCm39) M391K possibly damaging Het
Or4a80 T C 2: 89,583,298 (GRCm39) probably benign Het
Or5h19 T C 16: 58,856,530 (GRCm39) D190G probably damaging Het
Or6c69c A T 10: 129,910,485 (GRCm39) I69F probably benign Het
Pgk2 A G 17: 40,518,777 (GRCm39) V217A probably damaging Het
Pira13 G A 7: 3,819,928 (GRCm39) S663L unknown Het
Polr3a T C 14: 24,502,383 (GRCm39) T1257A probably benign Het
Pwwp2b A T 7: 138,836,086 (GRCm39) H509L possibly damaging Het
Qser1 C T 2: 104,618,098 (GRCm39) V815I probably damaging Het
Rif1 T G 2: 52,000,493 (GRCm39) S1316A probably benign Het
Rnf121 T A 7: 101,678,333 (GRCm39) K171N probably damaging Het
Samd9l G A 6: 3,377,064 (GRCm39) L66F probably damaging Het
Serac1 A T 17: 6,094,477 (GRCm39) I626N probably damaging Het
Setx T C 2: 29,035,275 (GRCm39) C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,640,271 (GRCm39) probably benign Het
Shc4 A G 2: 125,491,064 (GRCm39) probably null Het
Slc16a8 C T 15: 79,136,513 (GRCm39) V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slit3 A G 11: 35,560,968 (GRCm39) H971R probably damaging Het
Sp100 T A 1: 85,627,472 (GRCm39) probably benign Het
Stfa1 C A 16: 36,105,615 (GRCm39) Y115* probably null Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Timm44 A T 8: 4,320,019 (GRCm39) S50T probably benign Het
Trim25 G A 11: 88,904,340 (GRCm39) V378I probably benign Het
Ttn T C 2: 76,725,904 (GRCm39) S6111G unknown Het
Urb1 C A 16: 90,600,311 (GRCm39) M157I probably benign Het
Zbtb4 C A 11: 69,668,989 (GRCm39) Q571K possibly damaging Het
Zfp985 A T 4: 147,668,080 (GRCm39) H316L probably damaging Het
Zfp990 A T 4: 145,264,246 (GRCm39) I415L probably benign Het
Other mutations in Fcgbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fcgbpl1 APN 7 27,863,953 (GRCm39) missense probably damaging 1.00
IGL00757:Fcgbpl1 APN 7 27,853,870 (GRCm39) missense probably damaging 1.00
IGL01015:Fcgbpl1 APN 7 27,854,743 (GRCm39) missense probably damaging 1.00
IGL01079:Fcgbpl1 APN 7 27,839,203 (GRCm39) missense probably damaging 0.99
IGL01343:Fcgbpl1 APN 7 27,850,127 (GRCm39) missense probably benign 0.19
IGL01420:Fcgbpl1 APN 7 27,839,558 (GRCm39) missense probably benign 0.28
IGL01604:Fcgbpl1 APN 7 27,854,749 (GRCm39) missense probably benign 0.11
IGL01666:Fcgbpl1 APN 7 27,852,717 (GRCm39) missense probably damaging 1.00
IGL02002:Fcgbpl1 APN 7 27,852,221 (GRCm39) missense probably damaging 1.00
IGL02036:Fcgbpl1 APN 7 27,836,950 (GRCm39) missense possibly damaging 0.82
IGL02126:Fcgbpl1 APN 7 27,839,281 (GRCm39) missense probably damaging 1.00
IGL02150:Fcgbpl1 APN 7 27,846,204 (GRCm39) nonsense probably null
IGL02219:Fcgbpl1 APN 7 27,854,060 (GRCm39) missense probably damaging 1.00
IGL02563:Fcgbpl1 APN 7 27,857,317 (GRCm39) missense probably benign
IGL02804:Fcgbpl1 APN 7 27,852,795 (GRCm39) missense probably benign 0.00
IGL02830:Fcgbpl1 APN 7 27,862,348 (GRCm39) missense probably damaging 1.00
IGL02943:Fcgbpl1 APN 7 27,846,613 (GRCm39) missense probably damaging 1.00
IGL02977:Fcgbpl1 APN 7 27,863,797 (GRCm39) missense possibly damaging 0.83
IGL03231:Fcgbpl1 APN 7 27,853,147 (GRCm39) missense possibly damaging 0.95
IGL03304:Fcgbpl1 APN 7 27,841,667 (GRCm39) missense probably damaging 0.99
herz UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
pulse UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
Sinusoidal UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
PIT4378001:Fcgbpl1 UTSW 7 27,853,889 (GRCm39) missense possibly damaging 0.61
R0023:Fcgbpl1 UTSW 7 27,852,837 (GRCm39) missense probably benign 0.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0132:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0158:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R0230:Fcgbpl1 UTSW 7 27,856,250 (GRCm39) missense probably damaging 1.00
R0310:Fcgbpl1 UTSW 7 27,841,699 (GRCm39) missense probably benign 0.04
R0448:Fcgbpl1 UTSW 7 27,839,660 (GRCm39) missense probably benign 0.03
R0462:Fcgbpl1 UTSW 7 27,836,765 (GRCm39) missense probably damaging 1.00
R0481:Fcgbpl1 UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
R0497:Fcgbpl1 UTSW 7 27,846,890 (GRCm39) missense probably damaging 1.00
R0556:Fcgbpl1 UTSW 7 27,858,803 (GRCm39) missense probably benign
R0562:Fcgbpl1 UTSW 7 27,862,115 (GRCm39) missense probably benign 0.30
R0586:Fcgbpl1 UTSW 7 27,836,516 (GRCm39) missense probably damaging 0.99
R0924:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R0930:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R1103:Fcgbpl1 UTSW 7 27,853,945 (GRCm39) missense probably damaging 1.00
R1213:Fcgbpl1 UTSW 7 27,857,098 (GRCm39) missense probably damaging 1.00
R1292:Fcgbpl1 UTSW 7 27,842,219 (GRCm39) splice site probably benign
R1368:Fcgbpl1 UTSW 7 27,858,903 (GRCm39) missense possibly damaging 0.89
R1451:Fcgbpl1 UTSW 7 27,836,582 (GRCm39) missense probably damaging 1.00
R1477:Fcgbpl1 UTSW 7 27,856,518 (GRCm39) missense probably benign 0.01
R1538:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R1655:Fcgbpl1 UTSW 7 27,846,535 (GRCm39) missense probably damaging 0.98
R1697:Fcgbpl1 UTSW 7 27,853,772 (GRCm39) missense probably damaging 1.00
R1741:Fcgbpl1 UTSW 7 27,857,279 (GRCm39) missense probably damaging 0.98
R1796:Fcgbpl1 UTSW 7 27,854,797 (GRCm39) missense probably damaging 1.00
R1853:Fcgbpl1 UTSW 7 27,854,971 (GRCm39) nonsense probably null
R1861:Fcgbpl1 UTSW 7 27,854,157 (GRCm39) missense probably damaging 1.00
R1909:Fcgbpl1 UTSW 7 27,843,773 (GRCm39) missense possibly damaging 0.52
R1971:Fcgbpl1 UTSW 7 27,830,937 (GRCm39) missense possibly damaging 0.90
R1990:Fcgbpl1 UTSW 7 27,853,785 (GRCm39) missense probably damaging 0.98
R2020:Fcgbpl1 UTSW 7 27,855,019 (GRCm39) missense probably benign
R2084:Fcgbpl1 UTSW 7 27,856,960 (GRCm39) missense probably damaging 1.00
R2125:Fcgbpl1 UTSW 7 27,857,447 (GRCm39) missense probably benign 0.00
R2132:Fcgbpl1 UTSW 7 27,854,899 (GRCm39) missense probably damaging 1.00
R2513:Fcgbpl1 UTSW 7 27,831,060 (GRCm39) missense probably damaging 0.99
R2913:Fcgbpl1 UTSW 7 27,863,732 (GRCm39) missense probably damaging 1.00
R3150:Fcgbpl1 UTSW 7 27,853,620 (GRCm39) missense probably benign 0.21
R3499:Fcgbpl1 UTSW 7 27,853,980 (GRCm39) missense probably benign 0.42
R3702:Fcgbpl1 UTSW 7 27,857,203 (GRCm39) missense probably damaging 1.00
R3881:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R3938:Fcgbpl1 UTSW 7 27,853,719 (GRCm39) missense probably damaging 1.00
R4050:Fcgbpl1 UTSW 7 27,852,410 (GRCm39) missense possibly damaging 0.55
R4152:Fcgbpl1 UTSW 7 27,856,322 (GRCm39) missense possibly damaging 0.47
R4168:Fcgbpl1 UTSW 7 27,836,534 (GRCm39) missense probably benign 0.05
R4235:Fcgbpl1 UTSW 7 27,856,073 (GRCm39) missense probably damaging 0.99
R4241:Fcgbpl1 UTSW 7 27,853,760 (GRCm39) missense probably damaging 1.00
R4363:Fcgbpl1 UTSW 7 27,846,331 (GRCm39) missense probably damaging 1.00
R4460:Fcgbpl1 UTSW 7 27,852,281 (GRCm39) missense probably benign 0.17
R4463:Fcgbpl1 UTSW 7 27,850,144 (GRCm39) missense probably benign
R4841:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4842:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4876:Fcgbpl1 UTSW 7 27,842,225 (GRCm39) intron probably benign
R4905:Fcgbpl1 UTSW 7 27,856,408 (GRCm39) missense possibly damaging 0.93
R4997:Fcgbpl1 UTSW 7 27,843,349 (GRCm39) missense possibly damaging 0.77
R5091:Fcgbpl1 UTSW 7 27,856,383 (GRCm39) missense probably benign 0.44
R5159:Fcgbpl1 UTSW 7 27,852,733 (GRCm39) missense probably benign 0.09
R5326:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5396:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign
R5441:Fcgbpl1 UTSW 7 27,856,339 (GRCm39) missense probably damaging 1.00
R5480:Fcgbpl1 UTSW 7 27,857,424 (GRCm39) nonsense probably null
R5542:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5571:Fcgbpl1 UTSW 7 27,855,994 (GRCm39) missense probably damaging 0.99
R5613:Fcgbpl1 UTSW 7 27,842,303 (GRCm39) intron probably benign
R5637:Fcgbpl1 UTSW 7 27,852,277 (GRCm39) missense probably benign 0.00
R5766:Fcgbpl1 UTSW 7 27,836,754 (GRCm39) nonsense probably null
R6174:Fcgbpl1 UTSW 7 27,839,384 (GRCm39) missense probably damaging 0.96
R6233:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R6250:Fcgbpl1 UTSW 7 27,850,139 (GRCm39) missense probably damaging 1.00
R6379:Fcgbpl1 UTSW 7 27,857,017 (GRCm39) missense probably damaging 1.00
R6442:Fcgbpl1 UTSW 7 27,843,611 (GRCm39) missense possibly damaging 0.88
R6478:Fcgbpl1 UTSW 7 27,854,798 (GRCm39) missense probably damaging 1.00
R6699:Fcgbpl1 UTSW 7 27,843,793 (GRCm39) missense probably damaging 1.00
R6852:Fcgbpl1 UTSW 7 27,846,560 (GRCm39) missense probably damaging 1.00
R6883:Fcgbpl1 UTSW 7 27,852,260 (GRCm39) missense possibly damaging 0.89
R6902:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6903:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6904:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6992:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign 0.04
R7023:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R7039:Fcgbpl1 UTSW 7 27,839,573 (GRCm39) missense possibly damaging 0.80
R7171:Fcgbpl1 UTSW 7 27,853,944 (GRCm39) nonsense probably null
R7282:Fcgbpl1 UTSW 7 27,843,833 (GRCm39) missense probably benign 0.02
R7291:Fcgbpl1 UTSW 7 27,839,645 (GRCm39) missense probably benign
R7344:Fcgbpl1 UTSW 7 27,852,185 (GRCm39) missense possibly damaging 0.46
R7344:Fcgbpl1 UTSW 7 27,839,704 (GRCm39) missense possibly damaging 0.79
R7392:Fcgbpl1 UTSW 7 27,863,797 (GRCm39) missense possibly damaging 0.83
R7531:Fcgbpl1 UTSW 7 27,839,656 (GRCm39) missense probably benign
R7541:Fcgbpl1 UTSW 7 27,843,681 (GRCm39) nonsense probably null
R7577:Fcgbpl1 UTSW 7 27,853,848 (GRCm39) missense possibly damaging 0.65
R7594:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R7647:Fcgbpl1 UTSW 7 27,839,470 (GRCm39) missense probably benign 0.00
R7718:Fcgbpl1 UTSW 7 27,846,626 (GRCm39) missense probably damaging 1.00
R7733:Fcgbpl1 UTSW 7 27,839,390 (GRCm39) missense probably damaging 1.00
R7737:Fcgbpl1 UTSW 7 27,856,498 (GRCm39) missense probably damaging 1.00
R7908:Fcgbpl1 UTSW 7 27,846,921 (GRCm39) missense probably benign 0.12
R8013:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8014:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8151:Fcgbpl1 UTSW 7 27,852,766 (GRCm39) missense possibly damaging 0.95
R8175:Fcgbpl1 UTSW 7 27,863,873 (GRCm39) nonsense probably null
R8254:Fcgbpl1 UTSW 7 27,846,774 (GRCm39) missense possibly damaging 0.63
R8345:Fcgbpl1 UTSW 7 27,854,785 (GRCm39) missense probably damaging 1.00
R8414:Fcgbpl1 UTSW 7 27,842,158 (GRCm39) missense probably damaging 1.00
R8419:Fcgbpl1 UTSW 7 27,843,346 (GRCm39) missense probably damaging 1.00
R8496:Fcgbpl1 UTSW 7 27,843,377 (GRCm39) missense possibly damaging 0.81
R8691:Fcgbpl1 UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
R8863:Fcgbpl1 UTSW 7 27,831,006 (GRCm39) missense probably damaging 1.00
R8926:Fcgbpl1 UTSW 7 27,853,869 (GRCm39) missense probably damaging 1.00
R8950:Fcgbpl1 UTSW 7 27,863,751 (GRCm39) missense probably benign 0.32
R9014:Fcgbpl1 UTSW 7 27,854,876 (GRCm39) missense probably damaging 1.00
R9045:Fcgbpl1 UTSW 7 27,853,856 (GRCm39) missense probably damaging 1.00
R9115:Fcgbpl1 UTSW 7 27,853,754 (GRCm39) missense possibly damaging 0.74
R9233:Fcgbpl1 UTSW 7 27,839,519 (GRCm39) missense possibly damaging 0.83
R9330:Fcgbpl1 UTSW 7 27,856,410 (GRCm39) missense probably benign 0.02
R9426:Fcgbpl1 UTSW 7 27,843,281 (GRCm39) missense possibly damaging 0.92
R9477:Fcgbpl1 UTSW 7 27,852,265 (GRCm39) missense probably damaging 1.00
R9502:Fcgbpl1 UTSW 7 27,836,891 (GRCm39) missense probably benign 0.09
R9505:Fcgbpl1 UTSW 7 27,841,909 (GRCm39) nonsense probably null
R9601:Fcgbpl1 UTSW 7 27,853,805 (GRCm39) missense possibly damaging 0.78
R9630:Fcgbpl1 UTSW 7 27,836,624 (GRCm39) missense probably damaging 1.00
R9632:Fcgbpl1 UTSW 7 27,841,726 (GRCm39) missense probably benign
R9673:Fcgbpl1 UTSW 7 27,856,044 (GRCm39) missense probably benign 0.25
R9735:Fcgbpl1 UTSW 7 27,856,435 (GRCm39) missense probably damaging 1.00
Z1176:Fcgbpl1 UTSW 7 27,854,187 (GRCm39) missense probably benign 0.03
Z1176:Fcgbpl1 UTSW 7 27,841,811 (GRCm39) missense probably benign 0.06
Z1177:Fcgbpl1 UTSW 7 27,839,323 (GRCm39) missense probably benign 0.25
Z1186:Fcgbpl1 UTSW 7 27,856,411 (GRCm39) missense probably benign 0.01
Z1186:Fcgbpl1 UTSW 7 27,846,130 (GRCm39) missense probably benign 0.00
Z1186:Fcgbpl1 UTSW 7 27,830,997 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTCCTTGGTCTGCAAGC -3'
(R):5'- CCATGCTGGGAAAGATGCTC -3'

Sequencing Primer
(F):5'- TGGAGAGATCGGCTGCCAAC -3'
(R):5'- CTGGGAAAGATGCTCTGTACACC -3'
Posted On 2021-04-30