Incidental Mutation 'R8785:Timm44'
ID 670564
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Name translocase of inner mitochondrial membrane 44
Synonyms D8Ertd118e, Mimt44, 0710005E20Rik, Tim44
MMRRC Submission 068722-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 4309731-4325905 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4320019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 50 (S50T)
Ref Sequence ENSEMBL: ENSMUSP00000003029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029]
AlphaFold O35857
Predicted Effect probably benign
Transcript: ENSMUST00000003029
AA Change: S50T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: S50T

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,729,656 (GRCm39) D248V probably damaging Het
Acsm1 A T 7: 119,261,453 (GRCm39) T557S probably benign Het
Actn2 C A 13: 12,292,317 (GRCm39) A648S probably benign Het
Adam18 A T 8: 25,140,911 (GRCm39) I280N probably damaging Het
Adgb T A 10: 10,233,710 (GRCm39) I1256F probably damaging Het
Afap1 A T 5: 36,108,304 (GRCm39) K217* probably null Het
Amigo1 T C 3: 108,094,666 (GRCm39) V55A probably benign Het
Ank2 G A 3: 126,791,570 (GRCm39) R799W probably damaging Het
Atf7 T C 15: 102,454,974 (GRCm39) T265A probably benign Het
Atf7ip A T 6: 136,564,162 (GRCm39) T794S probably damaging Het
Atp13a3 A G 16: 30,169,800 (GRCm39) I426T probably benign Het
Atp5f1a T A 18: 77,866,923 (GRCm39) D265E probably benign Het
Cct6b A G 11: 82,632,157 (GRCm39) L277P probably damaging Het
Cdh23 T A 10: 60,147,114 (GRCm39) T2745S probably damaging Het
Cfap44 C T 16: 44,275,895 (GRCm39) T1385M probably damaging Het
Cpa1 C T 6: 30,645,251 (GRCm39) T409I probably benign Het
Cplane1 T C 15: 8,204,244 (GRCm39) F39S probably benign Het
Csmd3 G A 15: 48,177,482 (GRCm39) A352V probably benign Het
Cyp11b2 C T 15: 74,723,961 (GRCm39) A341T probably benign Het
Ddx43 A T 9: 78,329,041 (GRCm39) E630V possibly damaging Het
Dusp3 C G 11: 101,872,560 (GRCm39) E11Q probably benign Het
Eme1 C A 11: 94,541,447 (GRCm39) G125V probably benign Het
Fbxo7 C T 10: 85,860,410 (GRCm39) P85S probably benign Het
Fcgbpl1 C T 7: 27,854,132 (GRCm39) H1699Y probably damaging Het
Gcc2 T A 10: 58,107,086 (GRCm39) I774K probably benign Het
Gldc A T 19: 30,092,634 (GRCm39) C762S probably damaging Het
Gnmt T G 17: 47,038,313 (GRCm39) D71A probably damaging Het
Golgb1 T A 16: 36,740,106 (GRCm39) V2856E probably damaging Het
Gpr160 T C 3: 30,950,923 (GRCm39) S332P probably damaging Het
Gria4 A C 9: 4,456,106 (GRCm39) N731K probably damaging Het
Gria4 A G 9: 4,795,189 (GRCm39) I29T possibly damaging Het
Grk1 C T 8: 13,458,058 (GRCm39) probably benign Het
Hycc1 A G 5: 24,169,904 (GRCm39) S482P probably damaging Het
Ints11 G A 4: 155,954,165 (GRCm39) V6I probably benign Het
Irgq C A 7: 24,233,005 (GRCm39) T282K probably damaging Het
Itih2 T A 2: 10,102,780 (GRCm39) T785S probably benign Het
Lrrc37a G A 11: 103,347,242 (GRCm39) T3151I probably damaging Het
Macf1 T A 4: 123,342,053 (GRCm39) probably null Het
Mcm6 T C 1: 128,262,535 (GRCm39) N725S probably benign Het
Mmp14 T A 14: 54,674,232 (GRCm39) F181I probably damaging Het
Ms4a6d A G 19: 11,570,400 (GRCm39) probably benign Het
Myf5 A G 10: 107,321,548 (GRCm39) M82T probably benign Het
Neb A G 2: 52,059,902 (GRCm39) S6330P probably damaging Het
Nlrp2 T A 7: 5,330,548 (GRCm39) H616L probably damaging Het
Noxred1 T C 12: 87,270,940 (GRCm39) N227S probably benign Het
Nup214 T A 2: 31,924,465 (GRCm39) F1665I probably damaging Het
Nup50l A T 6: 96,141,871 (GRCm39) M391K possibly damaging Het
Or4a80 T C 2: 89,583,298 (GRCm39) probably benign Het
Or5h19 T C 16: 58,856,530 (GRCm39) D190G probably damaging Het
Or6c69c A T 10: 129,910,485 (GRCm39) I69F probably benign Het
Pgk2 A G 17: 40,518,777 (GRCm39) V217A probably damaging Het
Pira13 G A 7: 3,819,928 (GRCm39) S663L unknown Het
Polr3a T C 14: 24,502,383 (GRCm39) T1257A probably benign Het
Pwwp2b A T 7: 138,836,086 (GRCm39) H509L possibly damaging Het
Qser1 C T 2: 104,618,098 (GRCm39) V815I probably damaging Het
Rif1 T G 2: 52,000,493 (GRCm39) S1316A probably benign Het
Rnf121 T A 7: 101,678,333 (GRCm39) K171N probably damaging Het
Samd9l G A 6: 3,377,064 (GRCm39) L66F probably damaging Het
Serac1 A T 17: 6,094,477 (GRCm39) I626N probably damaging Het
Setx T C 2: 29,035,275 (GRCm39) C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,640,271 (GRCm39) probably benign Het
Shc4 A G 2: 125,491,064 (GRCm39) probably null Het
Slc16a8 C T 15: 79,136,513 (GRCm39) V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slit3 A G 11: 35,560,968 (GRCm39) H971R probably damaging Het
Sp100 T A 1: 85,627,472 (GRCm39) probably benign Het
Stfa1 C A 16: 36,105,615 (GRCm39) Y115* probably null Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Trim25 G A 11: 88,904,340 (GRCm39) V378I probably benign Het
Ttn T C 2: 76,725,904 (GRCm39) S6111G unknown Het
Urb1 C A 16: 90,600,311 (GRCm39) M157I probably benign Het
Zbtb4 C A 11: 69,668,989 (GRCm39) Q571K possibly damaging Het
Zfp985 A T 4: 147,668,080 (GRCm39) H316L probably damaging Het
Zfp990 A T 4: 145,264,246 (GRCm39) I415L probably benign Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4,325,888 (GRCm39) utr 5 prime probably benign
IGL01768:Timm44 APN 8 4,316,860 (GRCm39) missense probably benign 0.00
IGL02336:Timm44 APN 8 4,317,692 (GRCm39) missense probably damaging 1.00
lassie UTSW 8 4,310,621 (GRCm39) missense probably damaging 1.00
Togo UTSW 8 4,320,019 (GRCm39) missense probably benign 0.10
R0505:Timm44 UTSW 8 4,310,532 (GRCm39) nonsense probably null
R0883:Timm44 UTSW 8 4,316,592 (GRCm39) missense probably benign
R1842:Timm44 UTSW 8 4,310,510 (GRCm39) critical splice donor site probably null
R1965:Timm44 UTSW 8 4,310,603 (GRCm39) missense possibly damaging 0.65
R2243:Timm44 UTSW 8 4,317,871 (GRCm39) missense possibly damaging 0.91
R2318:Timm44 UTSW 8 4,318,307 (GRCm39) missense probably benign 0.18
R2518:Timm44 UTSW 8 4,316,588 (GRCm39) missense probably null 1.00
R4049:Timm44 UTSW 8 4,310,561 (GRCm39) missense probably benign 0.00
R4489:Timm44 UTSW 8 4,316,654 (GRCm39) missense possibly damaging 0.48
R4803:Timm44 UTSW 8 4,317,932 (GRCm39) missense probably damaging 0.99
R5001:Timm44 UTSW 8 4,325,886 (GRCm39) start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4,325,919 (GRCm39) splice site probably null
R5335:Timm44 UTSW 8 4,316,814 (GRCm39) missense probably damaging 1.00
R5502:Timm44 UTSW 8 4,319,992 (GRCm39) missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4,316,769 (GRCm39) critical splice donor site probably null
R5700:Timm44 UTSW 8 4,324,171 (GRCm39) missense probably damaging 1.00
R6004:Timm44 UTSW 8 4,317,747 (GRCm39) missense probably benign 0.00
R6186:Timm44 UTSW 8 4,316,824 (GRCm39) missense probably damaging 1.00
R6524:Timm44 UTSW 8 4,317,988 (GRCm39) missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4,317,282 (GRCm39) missense probably damaging 1.00
R6996:Timm44 UTSW 8 4,316,611 (GRCm39) missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4,317,311 (GRCm39) missense probably damaging 0.98
R7844:Timm44 UTSW 8 4,319,976 (GRCm39) missense possibly damaging 0.71
R8209:Timm44 UTSW 8 4,316,844 (GRCm39) missense probably benign 0.02
R8532:Timm44 UTSW 8 4,310,549 (GRCm39) missense possibly damaging 0.63
R9003:Timm44 UTSW 8 4,324,204 (GRCm39) missense possibly damaging 0.89
R9262:Timm44 UTSW 8 4,310,621 (GRCm39) missense probably damaging 1.00
R9537:Timm44 UTSW 8 4,310,576 (GRCm39) missense possibly damaging 0.90
R9759:Timm44 UTSW 8 4,317,707 (GRCm39) nonsense probably null
Z1088:Timm44 UTSW 8 4,318,004 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGACTGAGATACTCACATACTTCC -3'
(R):5'- GAACCTGTGAACATATAGGGCC -3'

Sequencing Primer
(F):5'- CTTCTGGCTTCCTGGAGAGC -3'
(R):5'- AGGGCCTACAATGTCATGTATCG -3'
Posted On 2021-04-30