Incidental Mutation 'R8785:Timm44'
ID 670564
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Name translocase of inner mitochondrial membrane 44
Synonyms Mimt44, 0710005E20Rik, Tim44, D8Ertd118e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 4259731-4275913 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4270019 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 50 (S50T)
Ref Sequence ENSEMBL: ENSMUSP00000003029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029]
AlphaFold O35857
Predicted Effect probably benign
Transcript: ENSMUST00000003029
AA Change: S50T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: S50T

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,890 M391K possibly damaging Het
2410089E03Rik T C 15: 8,174,760 F39S probably benign Het
9530053A07Rik C T 7: 28,154,707 H1699Y probably damaging Het
Abra T A 15: 41,866,260 D248V probably damaging Het
Acsm1 A T 7: 119,662,230 T557S probably benign Het
Actn2 C A 13: 12,277,431 A648S probably benign Het
Adam18 A T 8: 24,650,895 I280N probably damaging Het
Adgb T A 10: 10,357,966 I1256F probably damaging Het
Afap1 A T 5: 35,950,960 K217* probably null Het
Amigo1 T C 3: 108,187,350 V55A probably benign Het
Ank2 G A 3: 126,997,921 R799W probably damaging Het
Atf7 T C 15: 102,546,539 T265A probably benign Het
Atf7ip A T 6: 136,587,164 T794S probably damaging Het
Atp13a3 A G 16: 30,350,982 I426T probably benign Het
Atp5a1 T A 18: 77,779,223 D265E probably benign Het
Cct6b A G 11: 82,741,331 L277P probably damaging Het
Cdh23 T A 10: 60,311,335 T2745S probably damaging Het
Cfap44 C T 16: 44,455,532 T1385M probably damaging Het
Cpa1 C T 6: 30,645,252 T409I probably benign Het
Csmd3 G A 15: 48,314,086 A352V probably benign Het
Cyp11b2 C T 15: 74,852,112 A341T probably benign Het
Ddx43 A T 9: 78,421,759 E630V possibly damaging Het
Dusp3 C G 11: 101,981,734 E11Q probably benign Het
Eme1 C A 11: 94,650,621 G125V probably benign Het
Fam126a A G 5: 23,964,906 S482P probably damaging Het
Fbxo7 C T 10: 86,024,546 P85S probably benign Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gldc A T 19: 30,115,234 C762S probably damaging Het
Gm15448 G A 7: 3,816,929 S663L unknown Het
Gnmt T G 17: 46,727,387 D71A probably damaging Het
Golgb1 T A 16: 36,919,744 V2856E probably damaging Het
Gpr160 T C 3: 30,896,774 S332P probably damaging Het
Gria4 A C 9: 4,456,106 N731K probably damaging Het
Gria4 A G 9: 4,795,189 I29T possibly damaging Het
Grk1 C T 8: 13,408,058 probably benign Het
Ints11 G A 4: 155,869,708 V6I probably benign Het
Irgq C A 7: 24,533,580 T282K probably damaging Het
Itih2 T A 2: 10,097,969 T785S probably benign Het
Lrrc37a G A 11: 103,456,416 T3151I probably damaging Het
Macf1 T A 4: 123,448,260 probably null Het
Mcm6 T C 1: 128,334,798 N725S probably benign Het
Mmp14 T A 14: 54,436,775 F181I probably damaging Het
Ms4a6d A G 19: 11,593,036 probably benign Het
Myf5 A G 10: 107,485,687 M82T probably benign Het
Neb A G 2: 52,169,890 S6330P probably damaging Het
Nlrp2 T A 7: 5,327,549 H616L probably damaging Het
Noxred1 T C 12: 87,224,166 N227S probably benign Het
Nup214 T A 2: 32,034,453 F1665I probably damaging Het
Olfr1253 T C 2: 89,752,954 probably benign Het
Olfr187 T C 16: 59,036,167 D190G probably damaging Het
Olfr822 A T 10: 130,074,616 I69F probably benign Het
Pgk2 A G 17: 40,207,886 V217A probably damaging Het
Polr3a T C 14: 24,452,315 T1257A probably benign Het
Pwwp2b A T 7: 139,256,170 H509L possibly damaging Het
Qser1 C T 2: 104,787,753 V815I probably damaging Het
Rif1 T G 2: 52,110,481 S1316A probably benign Het
Rnf121 T A 7: 102,029,126 K171N probably damaging Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Serac1 A T 17: 6,044,202 I626N probably damaging Het
Setx T C 2: 29,145,263 C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Shc4 A G 2: 125,649,144 probably null Het
Slc16a8 C T 15: 79,252,313 V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slit3 A G 11: 35,670,141 H971R probably damaging Het
Sp100 T A 1: 85,699,751 probably benign Het
Stfa1 C A 16: 36,285,253 Y115* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Trim25 G A 11: 89,013,514 V378I probably benign Het
Ttn T C 2: 76,895,560 S6111G unknown Het
Urb1 C A 16: 90,803,423 M157I probably benign Het
Zbtb4 C A 11: 69,778,163 Q571K possibly damaging Het
Zfp985 A T 4: 147,583,623 H316L probably damaging Het
Zfp990 A T 4: 145,537,676 I415L probably benign Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4275888 utr 5 prime probably benign
IGL01768:Timm44 APN 8 4266860 missense probably benign 0.00
IGL02336:Timm44 APN 8 4267692 missense probably damaging 1.00
lassie UTSW 8 4260621 missense probably damaging 1.00
Togo UTSW 8 4270019 missense probably benign 0.10
R0505:Timm44 UTSW 8 4260532 nonsense probably null
R0883:Timm44 UTSW 8 4266592 missense probably benign
R1842:Timm44 UTSW 8 4260510 critical splice donor site probably null
R1965:Timm44 UTSW 8 4260603 missense possibly damaging 0.65
R2243:Timm44 UTSW 8 4267871 missense possibly damaging 0.91
R2318:Timm44 UTSW 8 4268307 missense probably benign 0.18
R2518:Timm44 UTSW 8 4266588 missense probably null 1.00
R4049:Timm44 UTSW 8 4260561 missense probably benign 0.00
R4489:Timm44 UTSW 8 4266654 missense possibly damaging 0.48
R4803:Timm44 UTSW 8 4267932 missense probably damaging 0.99
R5001:Timm44 UTSW 8 4275886 start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4275919 splice site probably null
R5335:Timm44 UTSW 8 4266814 missense probably damaging 1.00
R5502:Timm44 UTSW 8 4269992 missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4266769 critical splice donor site probably null
R5700:Timm44 UTSW 8 4274171 missense probably damaging 1.00
R6004:Timm44 UTSW 8 4267747 missense probably benign 0.00
R6186:Timm44 UTSW 8 4266824 missense probably damaging 1.00
R6524:Timm44 UTSW 8 4267988 missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4267282 missense probably damaging 1.00
R6996:Timm44 UTSW 8 4266611 missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4267311 missense probably damaging 0.98
R7844:Timm44 UTSW 8 4269976 missense possibly damaging 0.71
R8209:Timm44 UTSW 8 4266844 missense probably benign 0.02
R8532:Timm44 UTSW 8 4260549 missense possibly damaging 0.63
R9003:Timm44 UTSW 8 4274204 missense possibly damaging 0.89
R9262:Timm44 UTSW 8 4260621 missense probably damaging 1.00
R9537:Timm44 UTSW 8 4260576 missense possibly damaging 0.90
Z1088:Timm44 UTSW 8 4268004 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGACTGAGATACTCACATACTTCC -3'
(R):5'- GAACCTGTGAACATATAGGGCC -3'

Sequencing Primer
(F):5'- CTTCTGGCTTCCTGGAGAGC -3'
(R):5'- AGGGCCTACAATGTCATGTATCG -3'
Posted On 2021-04-30