Mutagenetix > Incidental Mutation

Incidental Mutation 'R8785:Gria4'

670566

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.633) question?

Stock #

R8785 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 4456106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 731 (N731K)

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000027020
AA Change: N731K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: N731K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000063508
AA Change: N731K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: N731K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212533
AA Change: N731K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,164,890	M391K	possibly damaging	Het
2410089E03Rik	T	C	15: 8,174,760	F39S	probably benign	Het
9530053A07Rik	C	T	7: 28,154,707	H1699Y	probably damaging	Het
Abra	T	A	15: 41,866,260	D248V	probably damaging	Het
Acsm1	A	T	7: 119,662,230	T557S	probably benign	Het
Actn2	C	A	13: 12,277,431	A648S	probably benign	Het
Adam18	A	T	8: 24,650,895	I280N	probably damaging	Het
Adgb	T	A	10: 10,357,966	I1256F	probably damaging	Het
Afap1	A	T	5: 35,950,960	K217*	probably null	Het
Amigo1	T	C	3: 108,187,350	V55A	probably benign	Het
Ank2	G	A	3: 126,997,921	R799W	probably damaging	Het
Atf7	T	C	15: 102,546,539	T265A	probably benign	Het
Atf7ip	A	T	6: 136,587,164	T794S	probably damaging	Het
Atp13a3	A	G	16: 30,350,982	I426T	probably benign	Het
Atp5a1	T	A	18: 77,779,223	D265E	probably benign	Het
Cct6b	A	G	11: 82,741,331	L277P	probably damaging	Het
Cdh23	T	A	10: 60,311,335	T2745S	probably damaging	Het
Cfap44	C	T	16: 44,455,532	T1385M	probably damaging	Het
Cpa1	C	T	6: 30,645,252	T409I	probably benign	Het
Csmd3	G	A	15: 48,314,086	A352V	probably benign	Het
Cyp11b2	C	T	15: 74,852,112	A341T	probably benign	Het
Ddx43	A	T	9: 78,421,759	E630V	possibly damaging	Het
Dusp3	C	G	11: 101,981,734	E11Q	probably benign	Het
Eme1	C	A	11: 94,650,621	G125V	probably benign	Het
Fam126a	A	G	5: 23,964,906	S482P	probably damaging	Het
Fbxo7	C	T	10: 86,024,546	P85S	probably benign	Het
Gcc2	T	A	10: 58,271,264	I774K	probably benign	Het
Gldc	A	T	19: 30,115,234	C762S	probably damaging	Het
Gm15448	G	A	7: 3,816,929	S663L	unknown	Het
Gnmt	T	G	17: 46,727,387	D71A	probably damaging	Het
Golgb1	T	A	16: 36,919,744	V2856E	probably damaging	Het
Gpr160	T	C	3: 30,896,774	S332P	probably damaging	Het
Grk1	C	T	8: 13,408,058		probably benign	Het
Ints11	G	A	4: 155,869,708	V6I	probably benign	Het
Irgq	C	A	7: 24,533,580	T282K	probably damaging	Het
Itih2	T	A	2: 10,097,969	T785S	probably benign	Het
Lrrc37a	G	A	11: 103,456,416	T3151I	probably damaging	Het
Macf1	T	A	4: 123,448,260		probably null	Het
Mcm6	T	C	1: 128,334,798	N725S	probably benign	Het
Mmp14	T	A	14: 54,436,775	F181I	probably damaging	Het
Ms4a6d	A	G	19: 11,593,036		probably benign	Het
Myf5	A	G	10: 107,485,687	M82T	probably benign	Het
Neb	A	G	2: 52,169,890	S6330P	probably damaging	Het
Nlrp2	T	A	7: 5,327,549	H616L	probably damaging	Het
Noxred1	T	C	12: 87,224,166	N227S	probably benign	Het
Nup214	T	A	2: 32,034,453	F1665I	probably damaging	Het
Olfr1253	T	C	2: 89,752,954		probably benign	Het
Olfr187	T	C	16: 59,036,167	D190G	probably damaging	Het
Olfr822	A	T	10: 130,074,616	I69F	probably benign	Het
Pgk2	A	G	17: 40,207,886	V217A	probably damaging	Het
Polr3a	T	C	14: 24,452,315	T1257A	probably benign	Het
Pwwp2b	A	T	7: 139,256,170	H509L	possibly damaging	Het
Qser1	C	T	2: 104,787,753	V815I	probably damaging	Het
Rif1	T	G	2: 52,110,481	S1316A	probably benign	Het
Rnf121	T	A	7: 102,029,126	K171N	probably damaging	Het
Samd9l	G	A	6: 3,377,064	L66F	probably damaging	Het
Serac1	A	T	17: 6,044,202	I626N	probably damaging	Het
Setx	T	C	2: 29,145,263	C587R	probably damaging	Het
Sf3a2	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	10: 80,804,437		probably benign	Het
Shc4	A	G	2: 125,649,144		probably null	Het
Slc16a8	C	T	15: 79,252,313	V230M	possibly damaging	Het
Slc5a4a	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC	10: 76,150,404		probably benign	Het
Slit3	A	G	11: 35,670,141	H971R	probably damaging	Het
Sp100	T	A	1: 85,699,751		probably benign	Het
Stfa1	C	A	16: 36,285,253	Y115*	probably null	Het
Syna	C	T	5: 134,559,869	M75I	probably benign	Het
Timm44	A	T	8: 4,270,019	S50T	probably benign	Het
Trim25	G	A	11: 89,013,514	V378I	probably benign	Het
Ttn	T	C	2: 76,895,560	S6111G	unknown	Het
Urb1	C	A	16: 90,803,423	M157I	probably benign	Het
Zbtb4	C	A	11: 69,778,163	Q571K	possibly damaging	Het
Zfp985	A	T	4: 147,583,623	H316L	probably damaging	Het
Zfp990	A	T	4: 145,537,676	I415L	probably benign	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATTCTTTCAGGGACATCAGGGAAG -3'
(R):5'- AGACTTACCGTAACCTCACTTCTG -3'

Sequencing Primer
(F):5'- AGGTGGAATACTATAACAATGCATG -3'
(R):5'- TCACTTCTGTCTATATTAACATGCTG -3'

Posted On

2021-04-30