Incidental Mutation 'R8785:Gria4'
ID 670567
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Gluralpha4, spkw1, Glur4, Glur-4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4795189 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 29 (I29T)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect possibly damaging
Transcript: ENSMUST00000027020
AA Change: I29T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: I29T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063508
AA Change: I29T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: I29T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163309
AA Change: I29T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: I29T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212533
AA Change: I29T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,890 M391K possibly damaging Het
2410089E03Rik T C 15: 8,174,760 F39S probably benign Het
9530053A07Rik C T 7: 28,154,707 H1699Y probably damaging Het
Abra T A 15: 41,866,260 D248V probably damaging Het
Acsm1 A T 7: 119,662,230 T557S probably benign Het
Actn2 C A 13: 12,277,431 A648S probably benign Het
Adam18 A T 8: 24,650,895 I280N probably damaging Het
Adgb T A 10: 10,357,966 I1256F probably damaging Het
Afap1 A T 5: 35,950,960 K217* probably null Het
Amigo1 T C 3: 108,187,350 V55A probably benign Het
Ank2 G A 3: 126,997,921 R799W probably damaging Het
Atf7 T C 15: 102,546,539 T265A probably benign Het
Atf7ip A T 6: 136,587,164 T794S probably damaging Het
Atp13a3 A G 16: 30,350,982 I426T probably benign Het
Atp5a1 T A 18: 77,779,223 D265E probably benign Het
Cct6b A G 11: 82,741,331 L277P probably damaging Het
Cdh23 T A 10: 60,311,335 T2745S probably damaging Het
Cfap44 C T 16: 44,455,532 T1385M probably damaging Het
Cpa1 C T 6: 30,645,252 T409I probably benign Het
Csmd3 G A 15: 48,314,086 A352V probably benign Het
Cyp11b2 C T 15: 74,852,112 A341T probably benign Het
Ddx43 A T 9: 78,421,759 E630V possibly damaging Het
Dusp3 C G 11: 101,981,734 E11Q probably benign Het
Eme1 C A 11: 94,650,621 G125V probably benign Het
Fam126a A G 5: 23,964,906 S482P probably damaging Het
Fbxo7 C T 10: 86,024,546 P85S probably benign Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gldc A T 19: 30,115,234 C762S probably damaging Het
Gm15448 G A 7: 3,816,929 S663L unknown Het
Gnmt T G 17: 46,727,387 D71A probably damaging Het
Golgb1 T A 16: 36,919,744 V2856E probably damaging Het
Gpr160 T C 3: 30,896,774 S332P probably damaging Het
Grk1 C T 8: 13,408,058 probably benign Het
Ints11 G A 4: 155,869,708 V6I probably benign Het
Irgq C A 7: 24,533,580 T282K probably damaging Het
Itih2 T A 2: 10,097,969 T785S probably benign Het
Lrrc37a G A 11: 103,456,416 T3151I probably damaging Het
Macf1 T A 4: 123,448,260 probably null Het
Mcm6 T C 1: 128,334,798 N725S probably benign Het
Mmp14 T A 14: 54,436,775 F181I probably damaging Het
Ms4a6d A G 19: 11,593,036 probably benign Het
Myf5 A G 10: 107,485,687 M82T probably benign Het
Neb A G 2: 52,169,890 S6330P probably damaging Het
Nlrp2 T A 7: 5,327,549 H616L probably damaging Het
Noxred1 T C 12: 87,224,166 N227S probably benign Het
Nup214 T A 2: 32,034,453 F1665I probably damaging Het
Olfr1253 T C 2: 89,752,954 probably benign Het
Olfr187 T C 16: 59,036,167 D190G probably damaging Het
Olfr822 A T 10: 130,074,616 I69F probably benign Het
Pgk2 A G 17: 40,207,886 V217A probably damaging Het
Polr3a T C 14: 24,452,315 T1257A probably benign Het
Pwwp2b A T 7: 139,256,170 H509L possibly damaging Het
Qser1 C T 2: 104,787,753 V815I probably damaging Het
Rif1 T G 2: 52,110,481 S1316A probably benign Het
Rnf121 T A 7: 102,029,126 K171N probably damaging Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Serac1 A T 17: 6,044,202 I626N probably damaging Het
Setx T C 2: 29,145,263 C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Shc4 A G 2: 125,649,144 probably null Het
Slc16a8 C T 15: 79,252,313 V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 76,150,404 probably benign Het
Slit3 A G 11: 35,670,141 H971R probably damaging Het
Sp100 T A 1: 85,699,751 probably benign Het
Stfa1 C A 16: 36,285,253 Y115* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Timm44 A T 8: 4,270,019 S50T probably benign Het
Trim25 G A 11: 89,013,514 V378I probably benign Het
Ttn T C 2: 76,895,560 S6111G unknown Het
Urb1 C A 16: 90,803,423 M157I probably benign Het
Zbtb4 C A 11: 69,778,163 Q571K possibly damaging Het
Zfp985 A T 4: 147,583,623 H316L probably damaging Het
Zfp990 A T 4: 145,537,676 I415L probably benign Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
R7909:Gria4 UTSW 9 4464450 missense probably damaging 1.00
R8007:Gria4 UTSW 9 4503740 splice site probably benign
R8044:Gria4 UTSW 9 4456216 missense probably damaging 1.00
R8062:Gria4 UTSW 9 4480273 missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4502429 missense probably benign 0.16
R8212:Gria4 UTSW 9 4480242 missense probably benign
R8478:Gria4 UTSW 9 4793882 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424347 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424351 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4456106 missense probably damaging 1.00
R8888:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R8895:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R9160:Gria4 UTSW 9 4424412 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTCTTGTTCTACGAAAACGAG -3'
(R):5'- AGCGCCATCATCTTCAATGC -3'

Sequencing Primer
(F):5'- GCAATCAAAGTCCATGAAGGTTTG -3'
(R):5'- GCCTCTCTGAAAATCATTTAGCAAG -3'
Posted On 2021-04-30