Incidental Mutation 'R8785:Slc5a4a'
ID 670572
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8785 (G1)
Quality Score 214.475
Status Validated
Chromosome 10
Chromosomal Location 76147451-76189265 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC to GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC at 76150404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020450
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,890 M391K possibly damaging Het
2410089E03Rik T C 15: 8,174,760 F39S probably benign Het
9530053A07Rik C T 7: 28,154,707 H1699Y probably damaging Het
Abra T A 15: 41,866,260 D248V probably damaging Het
Acsm1 A T 7: 119,662,230 T557S probably benign Het
Actn2 C A 13: 12,277,431 A648S probably benign Het
Adam18 A T 8: 24,650,895 I280N probably damaging Het
Adgb T A 10: 10,357,966 I1256F probably damaging Het
Afap1 A T 5: 35,950,960 K217* probably null Het
Amigo1 T C 3: 108,187,350 V55A probably benign Het
Ank2 G A 3: 126,997,921 R799W probably damaging Het
Atf7 T C 15: 102,546,539 T265A probably benign Het
Atf7ip A T 6: 136,587,164 T794S probably damaging Het
Atp13a3 A G 16: 30,350,982 I426T probably benign Het
Atp5a1 T A 18: 77,779,223 D265E probably benign Het
Cct6b A G 11: 82,741,331 L277P probably damaging Het
Cdh23 T A 10: 60,311,335 T2745S probably damaging Het
Cfap44 C T 16: 44,455,532 T1385M probably damaging Het
Cpa1 C T 6: 30,645,252 T409I probably benign Het
Csmd3 G A 15: 48,314,086 A352V probably benign Het
Cyp11b2 C T 15: 74,852,112 A341T probably benign Het
Ddx43 A T 9: 78,421,759 E630V possibly damaging Het
Dusp3 C G 11: 101,981,734 E11Q probably benign Het
Eme1 C A 11: 94,650,621 G125V probably benign Het
Fam126a A G 5: 23,964,906 S482P probably damaging Het
Fbxo7 C T 10: 86,024,546 P85S probably benign Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gldc A T 19: 30,115,234 C762S probably damaging Het
Gm15448 G A 7: 3,816,929 S663L unknown Het
Gnmt T G 17: 46,727,387 D71A probably damaging Het
Golgb1 T A 16: 36,919,744 V2856E probably damaging Het
Gpr160 T C 3: 30,896,774 S332P probably damaging Het
Gria4 A G 9: 4,795,189 I29T possibly damaging Het
Gria4 A C 9: 4,456,106 N731K probably damaging Het
Grk1 C T 8: 13,408,058 probably benign Het
Ints11 G A 4: 155,869,708 V6I probably benign Het
Irgq C A 7: 24,533,580 T282K probably damaging Het
Itih2 T A 2: 10,097,969 T785S probably benign Het
Lrrc37a G A 11: 103,456,416 T3151I probably damaging Het
Macf1 T A 4: 123,448,260 probably null Het
Mcm6 T C 1: 128,334,798 N725S probably benign Het
Mmp14 T A 14: 54,436,775 F181I probably damaging Het
Ms4a6d A G 19: 11,593,036 probably benign Het
Myf5 A G 10: 107,485,687 M82T probably benign Het
Neb A G 2: 52,169,890 S6330P probably damaging Het
Nlrp2 T A 7: 5,327,549 H616L probably damaging Het
Noxred1 T C 12: 87,224,166 N227S probably benign Het
Nup214 T A 2: 32,034,453 F1665I probably damaging Het
Olfr1253 T C 2: 89,752,954 probably benign Het
Olfr187 T C 16: 59,036,167 D190G probably damaging Het
Olfr822 A T 10: 130,074,616 I69F probably benign Het
Pgk2 A G 17: 40,207,886 V217A probably damaging Het
Polr3a T C 14: 24,452,315 T1257A probably benign Het
Pwwp2b A T 7: 139,256,170 H509L possibly damaging Het
Qser1 C T 2: 104,787,753 V815I probably damaging Het
Rif1 T G 2: 52,110,481 S1316A probably benign Het
Rnf121 T A 7: 102,029,126 K171N probably damaging Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Serac1 A T 17: 6,044,202 I626N probably damaging Het
Setx T C 2: 29,145,263 C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Shc4 A G 2: 125,649,144 probably null Het
Slc16a8 C T 15: 79,252,313 V230M possibly damaging Het
Slit3 A G 11: 35,670,141 H971R probably damaging Het
Sp100 T A 1: 85,699,751 probably benign Het
Stfa1 C A 16: 36,285,253 Y115* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Timm44 A T 8: 4,270,019 S50T probably benign Het
Trim25 G A 11: 89,013,514 V378I probably benign Het
Ttn T C 2: 76,895,560 S6111G unknown Het
Urb1 C A 16: 90,803,423 M157I probably benign Het
Zbtb4 C A 11: 69,778,163 Q571K possibly damaging Het
Zfp985 A T 4: 147,583,623 H316L probably damaging Het
Zfp990 A T 4: 145,537,676 I415L probably benign Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 splice site probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 76147550 missense unknown
R8929:Slc5a4a UTSW 10 76170783 missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76186535 missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76166712 missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76186562 missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76166774 missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTACCTGTTTCCAAGGAGTC -3'
(R):5'- GTGATTCAAACGCCGTGAC -3'

Sequencing Primer
(F):5'- TTGGGGGCCACATATCAGCTATC -3'
(R):5'- CGTGACAGCAATTCCTGAAGCTG -3'
Posted On 2021-04-30