Incidental Mutation 'R8785:Noxred1'
ID 670584
Institutional Source Beutler Lab
Gene Symbol Noxred1
Ensembl Gene ENSMUSG00000072919
Gene Name NADP+ dependent oxidoreductase domain containing 1
Synonyms 4933437F05Rik
MMRRC Submission 068722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 87267897-87285375 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87270940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 227 (N227S)
Ref Sequence ENSEMBL: ENSMUSP00000152486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021423] [ENSMUST00000221768] [ENSMUST00000222480]
AlphaFold Q9D3S5
Predicted Effect probably benign
Transcript: ENSMUST00000021423
AA Change: N227S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021423
Gene: ENSMUSG00000072919
AA Change: N227S

DomainStartEndE-ValueType
Pfam:F420_oxidored 80 173 1.1e-9 PFAM
low complexity region 261 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221768
Predicted Effect probably benign
Transcript: ENSMUST00000222480
AA Change: N227S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,729,656 (GRCm39) D248V probably damaging Het
Acsm1 A T 7: 119,261,453 (GRCm39) T557S probably benign Het
Actn2 C A 13: 12,292,317 (GRCm39) A648S probably benign Het
Adam18 A T 8: 25,140,911 (GRCm39) I280N probably damaging Het
Adgb T A 10: 10,233,710 (GRCm39) I1256F probably damaging Het
Afap1 A T 5: 36,108,304 (GRCm39) K217* probably null Het
Amigo1 T C 3: 108,094,666 (GRCm39) V55A probably benign Het
Ank2 G A 3: 126,791,570 (GRCm39) R799W probably damaging Het
Atf7 T C 15: 102,454,974 (GRCm39) T265A probably benign Het
Atf7ip A T 6: 136,564,162 (GRCm39) T794S probably damaging Het
Atp13a3 A G 16: 30,169,800 (GRCm39) I426T probably benign Het
Atp5f1a T A 18: 77,866,923 (GRCm39) D265E probably benign Het
Cct6b A G 11: 82,632,157 (GRCm39) L277P probably damaging Het
Cdh23 T A 10: 60,147,114 (GRCm39) T2745S probably damaging Het
Cfap44 C T 16: 44,275,895 (GRCm39) T1385M probably damaging Het
Cpa1 C T 6: 30,645,251 (GRCm39) T409I probably benign Het
Cplane1 T C 15: 8,204,244 (GRCm39) F39S probably benign Het
Csmd3 G A 15: 48,177,482 (GRCm39) A352V probably benign Het
Cyp11b2 C T 15: 74,723,961 (GRCm39) A341T probably benign Het
Ddx43 A T 9: 78,329,041 (GRCm39) E630V possibly damaging Het
Dusp3 C G 11: 101,872,560 (GRCm39) E11Q probably benign Het
Eme1 C A 11: 94,541,447 (GRCm39) G125V probably benign Het
Fbxo7 C T 10: 85,860,410 (GRCm39) P85S probably benign Het
Fcgbpl1 C T 7: 27,854,132 (GRCm39) H1699Y probably damaging Het
Gcc2 T A 10: 58,107,086 (GRCm39) I774K probably benign Het
Gldc A T 19: 30,092,634 (GRCm39) C762S probably damaging Het
Gnmt T G 17: 47,038,313 (GRCm39) D71A probably damaging Het
Golgb1 T A 16: 36,740,106 (GRCm39) V2856E probably damaging Het
Gpr160 T C 3: 30,950,923 (GRCm39) S332P probably damaging Het
Gria4 A C 9: 4,456,106 (GRCm39) N731K probably damaging Het
Gria4 A G 9: 4,795,189 (GRCm39) I29T possibly damaging Het
Grk1 C T 8: 13,458,058 (GRCm39) probably benign Het
Hycc1 A G 5: 24,169,904 (GRCm39) S482P probably damaging Het
Ints11 G A 4: 155,954,165 (GRCm39) V6I probably benign Het
Irgq C A 7: 24,233,005 (GRCm39) T282K probably damaging Het
Itih2 T A 2: 10,102,780 (GRCm39) T785S probably benign Het
Lrrc37a G A 11: 103,347,242 (GRCm39) T3151I probably damaging Het
Macf1 T A 4: 123,342,053 (GRCm39) probably null Het
Mcm6 T C 1: 128,262,535 (GRCm39) N725S probably benign Het
Mmp14 T A 14: 54,674,232 (GRCm39) F181I probably damaging Het
Ms4a6d A G 19: 11,570,400 (GRCm39) probably benign Het
Myf5 A G 10: 107,321,548 (GRCm39) M82T probably benign Het
Neb A G 2: 52,059,902 (GRCm39) S6330P probably damaging Het
Nlrp2 T A 7: 5,330,548 (GRCm39) H616L probably damaging Het
Nup214 T A 2: 31,924,465 (GRCm39) F1665I probably damaging Het
Nup50l A T 6: 96,141,871 (GRCm39) M391K possibly damaging Het
Or4a80 T C 2: 89,583,298 (GRCm39) probably benign Het
Or5h19 T C 16: 58,856,530 (GRCm39) D190G probably damaging Het
Or6c69c A T 10: 129,910,485 (GRCm39) I69F probably benign Het
Pgk2 A G 17: 40,518,777 (GRCm39) V217A probably damaging Het
Pira13 G A 7: 3,819,928 (GRCm39) S663L unknown Het
Polr3a T C 14: 24,502,383 (GRCm39) T1257A probably benign Het
Pwwp2b A T 7: 138,836,086 (GRCm39) H509L possibly damaging Het
Qser1 C T 2: 104,618,098 (GRCm39) V815I probably damaging Het
Rif1 T G 2: 52,000,493 (GRCm39) S1316A probably benign Het
Rnf121 T A 7: 101,678,333 (GRCm39) K171N probably damaging Het
Samd9l G A 6: 3,377,064 (GRCm39) L66F probably damaging Het
Serac1 A T 17: 6,094,477 (GRCm39) I626N probably damaging Het
Setx T C 2: 29,035,275 (GRCm39) C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,640,271 (GRCm39) probably benign Het
Shc4 A G 2: 125,491,064 (GRCm39) probably null Het
Slc16a8 C T 15: 79,136,513 (GRCm39) V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slit3 A G 11: 35,560,968 (GRCm39) H971R probably damaging Het
Sp100 T A 1: 85,627,472 (GRCm39) probably benign Het
Stfa1 C A 16: 36,105,615 (GRCm39) Y115* probably null Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Timm44 A T 8: 4,320,019 (GRCm39) S50T probably benign Het
Trim25 G A 11: 88,904,340 (GRCm39) V378I probably benign Het
Ttn T C 2: 76,725,904 (GRCm39) S6111G unknown Het
Urb1 C A 16: 90,600,311 (GRCm39) M157I probably benign Het
Zbtb4 C A 11: 69,668,989 (GRCm39) Q571K possibly damaging Het
Zfp985 A T 4: 147,668,080 (GRCm39) H316L probably damaging Het
Zfp990 A T 4: 145,264,246 (GRCm39) I415L probably benign Het
Other mutations in Noxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Noxred1 APN 12 87,269,955 (GRCm39) missense probably benign 0.05
IGL01950:Noxred1 APN 12 87,268,190 (GRCm39) missense probably damaging 1.00
IGL02381:Noxred1 APN 12 87,271,776 (GRCm39) missense probably damaging 0.98
IGL03109:Noxred1 APN 12 87,280,212 (GRCm39) missense probably damaging 1.00
PIT4402001:Noxred1 UTSW 12 87,273,855 (GRCm39) missense probably benign 0.00
PIT4504001:Noxred1 UTSW 12 87,271,653 (GRCm39) missense possibly damaging 0.89
R0242:Noxred1 UTSW 12 87,273,753 (GRCm39) missense probably benign 0.02
R0242:Noxred1 UTSW 12 87,273,753 (GRCm39) missense probably benign 0.02
R0514:Noxred1 UTSW 12 87,273,838 (GRCm39) missense probably benign 0.01
R0992:Noxred1 UTSW 12 87,271,000 (GRCm39) missense probably benign 0.15
R1626:Noxred1 UTSW 12 87,268,029 (GRCm39) makesense probably null
R2370:Noxred1 UTSW 12 87,273,820 (GRCm39) missense probably benign 0.00
R3692:Noxred1 UTSW 12 87,280,240 (GRCm39) missense probably benign 0.26
R4084:Noxred1 UTSW 12 87,280,258 (GRCm39) missense possibly damaging 0.67
R5868:Noxred1 UTSW 12 87,270,976 (GRCm39) missense possibly damaging 0.54
R6856:Noxred1 UTSW 12 87,273,810 (GRCm39) missense probably benign 0.00
R6977:Noxred1 UTSW 12 87,268,091 (GRCm39) missense probably null 0.00
R7388:Noxred1 UTSW 12 87,273,799 (GRCm39) missense probably damaging 0.99
R7535:Noxred1 UTSW 12 87,280,206 (GRCm39) missense probably benign 0.00
R7737:Noxred1 UTSW 12 87,268,136 (GRCm39) nonsense probably null
R7877:Noxred1 UTSW 12 87,271,761 (GRCm39) missense probably benign 0.34
R7939:Noxred1 UTSW 12 87,268,105 (GRCm39) missense probably benign 0.00
R8772:Noxred1 UTSW 12 87,273,867 (GRCm39) missense probably benign 0.14
R9470:Noxred1 UTSW 12 87,269,829 (GRCm39) missense possibly damaging 0.74
R9718:Noxred1 UTSW 12 87,271,692 (GRCm39) missense possibly damaging 0.91
Z1176:Noxred1 UTSW 12 87,269,831 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGCTCTTTGCATTCCAAAC -3'
(R):5'- GGCCTGAATTCAGATGCAGTAG -3'

Sequencing Primer
(F):5'- GCTTTGTGCTTTACAGACACAGAC -3'
(R):5'- CCTGAATTCAGATGCAGTAGATTGG -3'
Posted On 2021-04-30