Incidental Mutation 'R0070:Vmn2r88'
ID67060
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Namevomeronasal 2, receptor 88
SynonymsV2r3, V2r13
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0070 (G1)
Quality Score112
Status Validated
Chromosome14
Chromosomal Location51410819-51419527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51414140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 312 (T312S)
Ref Sequence ENSEMBL: ENSMUSP00000022438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: T312S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: T312S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159674
AA Change: T304S
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: T304S

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161565
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163019
AA Change: T279S
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: T279S

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: T304S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 splice site probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7882:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- AGTAGCCACCAAGGACACACATTTG -3'
(R):5'- TGTGGGCCACAGCATAAACAGC -3'

Sequencing Primer
(F):5'- GACAAGGGTATTCAGTTTCTCTCAG -3'
(R):5'- AGTGCTGTCCATTCCAATGTG -3'
Posted On2013-08-20