Incidental Mutation 'R8785:Gldc'
ID 670605
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 068722-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8785 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30092634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 762 (C762S)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: C762S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: C762S

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T A 15: 41,729,656 (GRCm39) D248V probably damaging Het
Acsm1 A T 7: 119,261,453 (GRCm39) T557S probably benign Het
Actn2 C A 13: 12,292,317 (GRCm39) A648S probably benign Het
Adam18 A T 8: 25,140,911 (GRCm39) I280N probably damaging Het
Adgb T A 10: 10,233,710 (GRCm39) I1256F probably damaging Het
Afap1 A T 5: 36,108,304 (GRCm39) K217* probably null Het
Amigo1 T C 3: 108,094,666 (GRCm39) V55A probably benign Het
Ank2 G A 3: 126,791,570 (GRCm39) R799W probably damaging Het
Atf7 T C 15: 102,454,974 (GRCm39) T265A probably benign Het
Atf7ip A T 6: 136,564,162 (GRCm39) T794S probably damaging Het
Atp13a3 A G 16: 30,169,800 (GRCm39) I426T probably benign Het
Atp5f1a T A 18: 77,866,923 (GRCm39) D265E probably benign Het
Cct6b A G 11: 82,632,157 (GRCm39) L277P probably damaging Het
Cdh23 T A 10: 60,147,114 (GRCm39) T2745S probably damaging Het
Cfap44 C T 16: 44,275,895 (GRCm39) T1385M probably damaging Het
Cpa1 C T 6: 30,645,251 (GRCm39) T409I probably benign Het
Cplane1 T C 15: 8,204,244 (GRCm39) F39S probably benign Het
Csmd3 G A 15: 48,177,482 (GRCm39) A352V probably benign Het
Cyp11b2 C T 15: 74,723,961 (GRCm39) A341T probably benign Het
Ddx43 A T 9: 78,329,041 (GRCm39) E630V possibly damaging Het
Dusp3 C G 11: 101,872,560 (GRCm39) E11Q probably benign Het
Eme1 C A 11: 94,541,447 (GRCm39) G125V probably benign Het
Fbxo7 C T 10: 85,860,410 (GRCm39) P85S probably benign Het
Fcgbpl1 C T 7: 27,854,132 (GRCm39) H1699Y probably damaging Het
Gcc2 T A 10: 58,107,086 (GRCm39) I774K probably benign Het
Gnmt T G 17: 47,038,313 (GRCm39) D71A probably damaging Het
Golgb1 T A 16: 36,740,106 (GRCm39) V2856E probably damaging Het
Gpr160 T C 3: 30,950,923 (GRCm39) S332P probably damaging Het
Gria4 A C 9: 4,456,106 (GRCm39) N731K probably damaging Het
Gria4 A G 9: 4,795,189 (GRCm39) I29T possibly damaging Het
Grk1 C T 8: 13,458,058 (GRCm39) probably benign Het
Hycc1 A G 5: 24,169,904 (GRCm39) S482P probably damaging Het
Ints11 G A 4: 155,954,165 (GRCm39) V6I probably benign Het
Irgq C A 7: 24,233,005 (GRCm39) T282K probably damaging Het
Itih2 T A 2: 10,102,780 (GRCm39) T785S probably benign Het
Lrrc37a G A 11: 103,347,242 (GRCm39) T3151I probably damaging Het
Macf1 T A 4: 123,342,053 (GRCm39) probably null Het
Mcm6 T C 1: 128,262,535 (GRCm39) N725S probably benign Het
Mmp14 T A 14: 54,674,232 (GRCm39) F181I probably damaging Het
Ms4a6d A G 19: 11,570,400 (GRCm39) probably benign Het
Myf5 A G 10: 107,321,548 (GRCm39) M82T probably benign Het
Neb A G 2: 52,059,902 (GRCm39) S6330P probably damaging Het
Nlrp2 T A 7: 5,330,548 (GRCm39) H616L probably damaging Het
Noxred1 T C 12: 87,270,940 (GRCm39) N227S probably benign Het
Nup214 T A 2: 31,924,465 (GRCm39) F1665I probably damaging Het
Nup50l A T 6: 96,141,871 (GRCm39) M391K possibly damaging Het
Or4a80 T C 2: 89,583,298 (GRCm39) probably benign Het
Or5h19 T C 16: 58,856,530 (GRCm39) D190G probably damaging Het
Or6c69c A T 10: 129,910,485 (GRCm39) I69F probably benign Het
Pgk2 A G 17: 40,518,777 (GRCm39) V217A probably damaging Het
Pira13 G A 7: 3,819,928 (GRCm39) S663L unknown Het
Polr3a T C 14: 24,502,383 (GRCm39) T1257A probably benign Het
Pwwp2b A T 7: 138,836,086 (GRCm39) H509L possibly damaging Het
Qser1 C T 2: 104,618,098 (GRCm39) V815I probably damaging Het
Rif1 T G 2: 52,000,493 (GRCm39) S1316A probably benign Het
Rnf121 T A 7: 101,678,333 (GRCm39) K171N probably damaging Het
Samd9l G A 6: 3,377,064 (GRCm39) L66F probably damaging Het
Serac1 A T 17: 6,094,477 (GRCm39) I626N probably damaging Het
Setx T C 2: 29,035,275 (GRCm39) C587R probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,640,271 (GRCm39) probably benign Het
Shc4 A G 2: 125,491,064 (GRCm39) probably null Het
Slc16a8 C T 15: 79,136,513 (GRCm39) V230M possibly damaging Het
Slc5a4a GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC 10: 75,986,238 (GRCm39) probably benign Het
Slit3 A G 11: 35,560,968 (GRCm39) H971R probably damaging Het
Sp100 T A 1: 85,627,472 (GRCm39) probably benign Het
Stfa1 C A 16: 36,105,615 (GRCm39) Y115* probably null Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Timm44 A T 8: 4,320,019 (GRCm39) S50T probably benign Het
Trim25 G A 11: 88,904,340 (GRCm39) V378I probably benign Het
Ttn T C 2: 76,725,904 (GRCm39) S6111G unknown Het
Urb1 C A 16: 90,600,311 (GRCm39) M157I probably benign Het
Zbtb4 C A 11: 69,668,989 (GRCm39) Q571K possibly damaging Het
Zfp985 A T 4: 147,668,080 (GRCm39) H316L probably damaging Het
Zfp990 A T 4: 145,264,246 (GRCm39) I415L probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTGGAAGTGCACTAG -3'
(R):5'- TCACTTTGACTGTGGAATGCC -3'

Sequencing Primer
(F):5'- GACATGAAGGTTAATTCCTCGGAC -3'
(R):5'- TCTTCGGGATCAAACTCAGGTAG -3'
Posted On 2021-04-30