Incidental Mutation 'R8786:Fry'
ID 670627
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene Name FRY microtubule binding protein
Synonyms 9330186A19Rik, cg003
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock # R8786 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 150118645-150497753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150394036 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 827 (V827A)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087204
AA Change: V827A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: V827A

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C A 2: 118,757,251 S534I unknown Het
Adamtsl4 A T 3: 95,685,474 M1K probably null Het
Atg2a G T 19: 6,244,430 V59L probably damaging Het
Atxn7 C A 14: 14,103,316 T888K possibly damaging Het
BC055324 A T 1: 163,964,471 L626Q probably damaging Het
Btbd9 T C 17: 30,530,170 R57G probably damaging Het
Catspere2 T A 1: 178,015,796 probably benign Het
Catspere2 G A 1: 178,015,989 probably benign Het
Crp T C 1: 172,698,726 V126A probably benign Het
Csf1r A T 18: 61,114,870 T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 N299S probably damaging Het
Dcaf17 T C 2: 71,087,400 probably null Het
Dip2c A G 13: 9,615,794 D985G probably damaging Het
Dtna A G 18: 23,583,133 T138A probably benign Het
Emid1 T C 11: 5,131,517 D212G probably benign Het
Epyc G A 10: 97,675,663 D173N probably damaging Het
Fanci A G 7: 79,402,550 D162G probably benign Het
Ggps1 T C 13: 14,053,920 E226G probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gopc G A 10: 52,354,654 R183* probably null Het
Grik4 C T 9: 42,541,834 G752S probably damaging Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
H2-Q1 T A 17: 35,320,893 V46D probably damaging Het
Hsd17b3 T C 13: 64,072,048 N126S probably damaging Het
Igsf10 G A 3: 59,330,642 T706I probably benign Het
Kmt2e A G 5: 23,464,866 D117G probably damaging Het
Kmt5a C T 5: 124,446,011 A18V probably benign Het
Krtap29-1 C T 11: 99,978,639 G139R probably damaging Het
Lama5 T C 2: 180,196,307 Y872C probably damaging Het
Lrriq4 T A 3: 30,650,603 M260K probably benign Het
Map2 G A 1: 66,433,596 probably benign Het
Mrpl51 C T 6: 125,192,377 A8V probably benign Het
Ndufs3 T C 2: 90,902,434 T103A probably benign Het
Numa1 T G 7: 101,998,409 L449R probably benign Het
Olfr1513 C T 14: 52,349,564 A161T possibly damaging Het
Pan3 C T 5: 147,488,141 P295S possibly damaging Het
Pds5b T C 5: 150,780,669 S846P probably damaging Het
Phf2 A T 13: 48,813,743 M712K unknown Het
Phlda2 A T 7: 143,502,474 V6E probably benign Het
Pkdrej C A 15: 85,819,843 A631S probably benign Het
Plcd3 G T 11: 103,071,743 N627K probably damaging Het
Prpf6 T C 2: 181,620,622 I138T possibly damaging Het
Psd4 G A 2: 24,405,432 S866N probably benign Het
Ptprb A C 10: 116,319,401 T400P probably benign Het
Rxfp1 T C 3: 79,663,370 probably null Het
Sbf2 A G 7: 110,464,586 probably null Het
Setd4 C T 16: 93,593,274 R89Q probably benign Het
Sgpp1 A G 12: 75,716,378 I343T probably benign Het
Sh2b2 T C 5: 136,231,804 D186G probably benign Het
Slc12a4 A T 8: 105,953,917 I191N probably damaging Het
Slc4a4 A T 5: 89,084,690 D251V probably benign Het
Slc6a5 A T 7: 49,912,095 D125V possibly damaging Het
Slf1 T A 13: 77,126,687 I16F possibly damaging Het
Sncaip T C 18: 52,898,262 V521A probably damaging Het
Stx19 T C 16: 62,822,412 L197P probably damaging Het
Sucla2 A G 14: 73,560,465 N39D probably benign Het
Sult1d1 T A 5: 87,564,716 T90S probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r138 A G 6: 40,612,677 S212P probably damaging Het
Tdrd3 T A 14: 87,472,201 C106* probably null Het
Tex43 T C 18: 56,594,496 F89L probably damaging Het
Tlk2 C T 11: 105,281,233 A743V unknown Het
Tlr3 T C 8: 45,398,249 D537G possibly damaging Het
Tmc1 A G 19: 20,826,589 Y375H probably damaging Het
Tsen54 T A 11: 115,820,672 M305K probably damaging Het
Umod C T 7: 119,477,358 V62M possibly damaging Het
Vmn1r10 A G 6: 57,114,025 T201A probably benign Het
Vmn1r103 T C 7: 20,509,751 T262A probably benign Het
Vmn2r100 T C 17: 19,522,576 V404A probably damaging Het
Vmn2r56 A G 7: 12,715,466 F282L probably damaging Het
Wdr64 A T 1: 175,808,761 K982* probably null Het
Xpo6 A T 7: 126,112,955 probably benign Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
Brook UTSW 5 150326132 missense probably damaging 1.00
haydn UTSW 5 150418464 missense possibly damaging 0.94
miracle UTSW 5 150437159 missense probably damaging 0.99
quickening UTSW 5 150434776 missense probably damaging 1.00
seasons UTSW 5 150466437 missense probably benign 0.06
Vivaldi UTSW 5 150394138 missense possibly damaging 0.80
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense
R4733:Fry UTSW 5 150386007 missense
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R7972:Fry UTSW 5 150310396 missense probably benign 0.05
R8058:Fry UTSW 5 150495767 missense
R8070:Fry UTSW 5 150478007 missense
R8159:Fry UTSW 5 150399533 missense probably benign 0.31
R8202:Fry UTSW 5 150431737 missense probably damaging 1.00
R8261:Fry UTSW 5 150445907 missense probably damaging 1.00
R8279:Fry UTSW 5 150496261 missense
R8338:Fry UTSW 5 150359051 missense probably damaging 0.99
R8370:Fry UTSW 5 150395819 missense probably damaging 1.00
R8673:Fry UTSW 5 150395111 missense possibly damaging 0.91
R8815:Fry UTSW 5 150394138 missense possibly damaging 0.80
R8847:Fry UTSW 5 150386007 missense
R9023:Fry UTSW 5 150437303 missense probably benign 0.00
R9025:Fry UTSW 5 150295808 intron probably benign
R9125:Fry UTSW 5 150346060 missense probably damaging 0.97
R9172:Fry UTSW 5 150413328 missense probably benign
R9262:Fry UTSW 5 150381644 missense probably damaging 1.00
R9263:Fry UTSW 5 150399263 missense probably damaging 1.00
R9293:Fry UTSW 5 150495832 missense
R9368:Fry UTSW 5 150477938 missense
R9401:Fry UTSW 5 150378938 missense probably damaging 1.00
R9402:Fry UTSW 5 150433696 missense possibly damaging 0.91
R9402:Fry UTSW 5 150436853 missense probably damaging 1.00
R9420:Fry UTSW 5 150433529 missense possibly damaging 0.72
R9557:Fry UTSW 5 150466316 missense
Z1177:Fry UTSW 5 150310437 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTCCCAGATCCAAAGCTGATCC -3'
(R):5'- GGCACCTTACTTTGGGTCTACC -3'

Sequencing Primer
(F):5'- AAAGCTGATCCGTGGCATC -3'
(R):5'- TCTACCAGCGGCATCACG -3'
Posted On 2021-04-30