Incidental Mutation 'R8786:Tas2r138'
ID670629
Institutional Source Beutler Lab
Gene Symbol Tas2r138
Ensembl Gene ENSMUSG00000058250
Gene Nametaste receptor, type 2, member 138
Synonymsmt2r31, T2R138, Tas2r38
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8786 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40612315-40613310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40612677 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 212 (S212P)
Ref Sequence ENSEMBL: ENSMUSP00000075876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076565]
Predicted Effect probably damaging
Transcript: ENSMUST00000076565
AA Change: S212P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075876
Gene: ENSMUSG00000058250
AA Change: S212P

DomainStartEndE-ValueType
Pfam:TAS2R 11 315 3.8e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C A 2: 118,757,251 S534I unknown Het
Adamtsl4 A T 3: 95,685,474 M1K probably null Het
Atg2a G T 19: 6,244,430 V59L probably damaging Het
Atxn7 C A 14: 14,103,316 T888K possibly damaging Het
BC055324 A T 1: 163,964,471 L626Q probably damaging Het
Btbd9 T C 17: 30,530,170 R57G probably damaging Het
Crp T C 1: 172,698,726 V126A probably benign Het
Csf1r A T 18: 61,114,870 T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 N299S probably damaging Het
Dcaf17 T C 2: 71,087,400 probably null Het
Dip2c A G 13: 9,615,794 D985G probably damaging Het
Dtna A G 18: 23,583,133 T138A probably benign Het
Emid1 T C 11: 5,131,517 D212G probably benign Het
Epyc G A 10: 97,675,663 D173N probably damaging Het
Fanci A G 7: 79,402,550 D162G probably benign Het
Fry T C 5: 150,394,036 V827A probably benign Het
Ggps1 T C 13: 14,053,920 E226G probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gopc G A 10: 52,354,654 R183* probably null Het
Grik4 C T 9: 42,541,834 G752S probably damaging Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
H2-Q1 T A 17: 35,320,893 V46D probably damaging Het
Hsd17b3 T C 13: 64,072,048 N126S probably damaging Het
Igsf10 G A 3: 59,330,642 T706I probably benign Het
Kmt2e A G 5: 23,464,866 D117G probably damaging Het
Krtap29-1 C T 11: 99,978,639 G139R probably damaging Het
Lama5 T C 2: 180,196,307 Y872C probably damaging Het
Lrriq4 T A 3: 30,650,603 M260K probably benign Het
Map2 G A 1: 66,433,596 probably benign Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mrpl51 C T 6: 125,192,377 A8V probably benign Het
Ndufs3 T C 2: 90,902,434 T103A probably benign Het
Numa1 T G 7: 101,998,409 L449R probably benign Het
Olfr1513 C T 14: 52,349,564 A161T possibly damaging Het
Pan3 C T 5: 147,488,141 P295S possibly damaging Het
Pds5b T C 5: 150,780,669 S846P probably damaging Het
Phf2 A T 13: 48,813,743 M712K unknown Het
Phlda2 A T 7: 143,502,474 V6E probably benign Het
Pkdrej C A 15: 85,819,843 A631S probably benign Het
Plcd3 G T 11: 103,071,743 N627K probably damaging Het
Prpf6 T C 2: 181,620,622 I138T possibly damaging Het
Psd4 G A 2: 24,405,432 S866N probably benign Het
Ptprb A C 10: 116,319,401 T400P probably benign Het
Rxfp1 T C 3: 79,663,370 probably null Het
Sbf2 A G 7: 110,464,586 probably null Het
Setd4 C T 16: 93,593,274 R89Q probably benign Het
Sgpp1 A G 12: 75,716,378 I343T probably benign Het
Sh2b2 T C 5: 136,231,804 D186G probably benign Het
Slc12a4 A T 8: 105,953,917 I191N probably damaging Het
Slc4a4 A T 5: 89,084,690 D251V probably benign Het
Slc6a5 A T 7: 49,912,095 D125V possibly damaging Het
Slf1 T A 13: 77,126,687 I16F possibly damaging Het
Sncaip T C 18: 52,898,262 V521A probably damaging Het
Stx19 T C 16: 62,822,412 L197P probably damaging Het
Sucla2 A G 14: 73,560,465 N39D probably benign Het
Sult1d1 T A 5: 87,564,716 T90S probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tdrd3 T A 14: 87,472,201 C106* probably null Het
Tex43 T C 18: 56,594,496 F89L probably damaging Het
Tlk2 C T 11: 105,281,233 A743V unknown Het
Tlr3 T C 8: 45,398,249 D537G possibly damaging Het
Tmc1 A G 19: 20,826,589 Y375H probably damaging Het
Tsen54 T A 11: 115,820,672 M305K probably damaging Het
Umod C T 7: 119,477,358 V62M possibly damaging Het
Vmn1r10 A G 6: 57,114,025 T201A probably benign Het
Vmn1r103 T C 7: 20,509,751 T262A probably benign Het
Vmn2r100 T C 17: 19,522,576 V404A probably damaging Het
Vmn2r56 A G 7: 12,715,466 F282L probably damaging Het
Wdr64 A T 1: 175,808,761 K982* probably null Het
Other mutations in Tas2r138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Tas2r138 APN 6 40612586 missense probably benign 0.07
IGL01468:Tas2r138 APN 6 40612476 missense probably benign 0.22
IGL02626:Tas2r138 APN 6 40612715 missense possibly damaging 0.61
IGL03008:Tas2r138 APN 6 40613182 missense probably damaging 1.00
R0595:Tas2r138 UTSW 6 40612865 missense probably damaging 1.00
R2845:Tas2r138 UTSW 6 40612767 missense probably benign 0.09
R2975:Tas2r138 UTSW 6 40613264 missense probably benign 0.00
R4202:Tas2r138 UTSW 6 40612476 missense possibly damaging 0.95
R4923:Tas2r138 UTSW 6 40612886 missense possibly damaging 0.82
R5526:Tas2r138 UTSW 6 40612980 missense probably benign 0.00
R6647:Tas2r138 UTSW 6 40612799 missense possibly damaging 0.91
R6869:Tas2r138 UTSW 6 40612421 missense probably damaging 1.00
R8781:Tas2r138 UTSW 6 40612916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCATAGCATCAGTAAGGG -3'
(R):5'- TGGGTCTCCAGGAGATTTCTTC -3'

Sequencing Primer
(F):5'- TGCCATAGCATCAGTAAGGGTATTG -3'
(R):5'- TCCAGGAGATTTCTTCAGATGC -3'
Posted On2021-04-30