Mutagenetix > Incidental Mutation

Incidental Mutation 'R0015:Vmn2r116'

67064

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r116

Ensembl Gene

ENSMUSG00000090966

Gene Name

vomeronasal 2, receptor 116

Synonyms

V2Rp5, EG619697

MMRRC Submission

038310-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R0015 (G1)

Quality Score

187

Status

Validated

Chromosome

Chromosomal Location

23384803-23401864 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23401849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 852 (N852K)

Ref Sequence

ENSEMBL: ENSMUSP00000128106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164856]

AlphaFold

E9Q6I0

Predicted Effect

probably benign
Transcript: ENSMUST00000164856
AA Change: N852K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: N852K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	4.4e-30	PFAM
Pfam:NCD3G	511	564	1.2e-22	PFAM
low complexity region	589	594	N/A	INTRINSIC
Pfam:7tm_3	595	832	8.7e-57	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.2%

Validation Efficiency

97% (71/73)

MGI Phenotype

PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,186,184	R408H	probably damaging	Het
A130050O07Rik	A	G	1: 137,928,656	Y23C	unknown	Het
Adcy3	G	A	12: 4,195,260		probably null	Het
Aldh6a1	G	A	12: 84,441,780	L86F	probably damaging	Het
Arl10	G	T	13: 54,575,957		probably benign	Het
Armc3	A	G	2: 19,296,321		probably null	Het
Astn2	T	G	4: 66,266,382		probably null	Het
Cacna1d	G	A	14: 30,114,971	T804I	probably benign	Het
Ccny	A	C	18: 9,316,682		probably benign	Het
Cdh5	C	T	8: 104,140,927	T612I	probably benign	Het
Cfap58	A	G	19: 48,029,100	M800V	probably benign	Het
Clrn1	A	T	3: 58,846,427	I171K	probably damaging	Het
Cnp	T	A	11: 100,578,908		probably null	Het
Col12a1	T	C	9: 79,651,385	T1933A	probably damaging	Het
Cwf19l2	A	G	9: 3,454,666	S660G	probably benign	Het
Dync1i2	C	A	2: 71,214,484	R13S	probably damaging	Het
Eps8l1	A	T	7: 4,477,557		probably benign	Het
Espn	T	C	4: 152,139,152	T188A	possibly damaging	Het
F2	T	C	2: 91,630,607	E260G	probably benign	Het
Fat4	T	A	3: 38,982,503	S3435T	probably damaging	Het
Fchsd1	A	G	18: 37,962,959	C533R	probably benign	Het
Fstl5	G	A	3: 76,322,191	V100M	probably damaging	Het
Gls2	T	G	10: 128,209,350	L572R	probably damaging	Het
Gm20939	A	T	17: 94,876,768	E281D	probably benign	Het
Gpr35	T	G	1: 92,983,232	L222W	probably damaging	Het
Hsf5	C	A	11: 87,657,335	H615N	probably benign	Het
Id2	C	T	12: 25,095,803	D70N	probably damaging	Het
Ints2	T	C	11: 86,249,287	T240A	probably damaging	Het
Kcnn3	A	C	3: 89,662,773	D631A	probably damaging	Het
Klhdc8a	A	G	1: 132,303,005	T203A	probably damaging	Het
Lama4	C	T	10: 39,075,436	T1059M	possibly damaging	Het
Lgals8	A	G	13: 12,447,298	L226P	probably damaging	Het
Lifr	T	A	15: 7,188,186		probably null	Het
Lonp1	T	A	17: 56,618,406	Q462L	probably benign	Het
Lypd1	A	G	1: 125,910,438	V48A	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,326	I67T	possibly damaging	Het
Mbd3l1	A	T	9: 18,484,858	D93V	probably benign	Het
Mdh1b	T	C	1: 63,721,800		probably benign	Het
Myh7b	C	T	2: 155,622,286	P569L	probably damaging	Het
Ncapd3	C	A	9: 27,051,809	A470E	probably damaging	Het
Ndrg2	A	G	14: 51,910,445		probably benign	Het
Nprl2	A	T	9: 107,544,419	I209F	probably damaging	Het
Ntrk1	A	G	3: 87,791,750		probably benign	Het
Olfm2	T	C	9: 20,668,741	E268G	probably damaging	Het
Olfr884	T	A	9: 38,047,667	Y148*	probably null	Het
Pcf11	T	A	7: 92,658,317	H881L	probably benign	Het
Pde10a	A	G	17: 8,977,197	D640G	probably damaging	Het
Pde9a	G	A	17: 31,386,356		probably null	Het
Pianp	G	T	6: 125,001,540	G236V	probably damaging	Het
Polr2g	A	G	19: 8,793,652	I160T	probably damaging	Het
Ppp1r3a	A	G	6: 14,717,661	S1085P	possibly damaging	Het
Pter	G	A	2: 13,001,000	G328D	probably damaging	Het
Rad51	T	A	2: 119,116,327	M5K	probably benign	Het
Rbm43	T	A	2: 51,925,667	I181F	probably benign	Het
Rgs12	T	C	5: 35,022,776		probably benign	Het
Rnf213	A	C	11: 119,441,606	D2547A	possibly damaging	Het
Slc20a2	C	A	8: 22,535,345	A21E	probably damaging	Het
Stab2	A	G	10: 86,843,617	S2503P	probably benign	Het
Sv2b	A	T	7: 75,125,641	F479L	probably damaging	Het
Sybu	T	C	15: 44,673,500	R349G	probably damaging	Het
Tead3	T	C	17: 28,341,351	Y2C	probably damaging	Het
Tnrc6c	T	A	11: 117,721,458	N307K	probably damaging	Het
Ubxn11	C	G	4: 134,116,025		probably null	Het
Ust	T	C	10: 8,330,065		probably benign	Het
Zgrf1	T	C	3: 127,555,397		probably benign	Het

Other mutations in Vmn2r116

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Vmn2r116	APN	17	23385995	missense	possibly damaging	0.94
IGL00985:Vmn2r116	APN	17	23401515	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23397727	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23387236	missense	probably benign	0.12
IGL01383:Vmn2r116	APN	17	23401601	missense	probably damaging	1.00
IGL01459:Vmn2r116	APN	17	23384929	missense	probably damaging	1.00
IGL01725:Vmn2r116	APN	17	23386645	missense	probably damaging	1.00
IGL02125:Vmn2r116	APN	17	23397627	splice site	probably benign
IGL02170:Vmn2r116	APN	17	23384933	missense	probably benign
IGL02209:Vmn2r116	APN	17	23388787	missense	probably damaging	1.00
IGL02226:Vmn2r116	APN	17	23384834	missense	probably null
IGL02272:Vmn2r116	APN	17	23385999	missense	probably benign	0.06
IGL02272:Vmn2r116	APN	17	23386004	missense	probably damaging	1.00
IGL02403:Vmn2r116	APN	17	23387364	missense	probably damaging	1.00
IGL02686:Vmn2r116	APN	17	23388793	missense	probably damaging	0.99
IGL02750:Vmn2r116	APN	17	23397634	splice site	probably benign
IGL02977:Vmn2r116	APN	17	23388774	missense	possibly damaging	0.90
PIT4449001:Vmn2r116	UTSW	17	23388947	missense	probably benign	0.41
R0219:Vmn2r116	UTSW	17	23386098	nonsense	probably null
R0281:Vmn2r116	UTSW	17	23401413	missense	possibly damaging	0.90
R0415:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
R0592:Vmn2r116	UTSW	17	23386915	missense	probably damaging	0.99
R0610:Vmn2r116	UTSW	17	23387312	missense	probably damaging	1.00
R0635:Vmn2r116	UTSW	17	23386887	missense	possibly damaging	0.95
R0843:Vmn2r116	UTSW	17	23400960	missense	probably benign	0.01
R1329:Vmn2r116	UTSW	17	23387188	missense	possibly damaging	0.89
R1396:Vmn2r116	UTSW	17	23386141	missense	probably benign
R1401:Vmn2r116	UTSW	17	23386596	splice site	probably benign
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1766:Vmn2r116	UTSW	17	23401766	missense	probably damaging	0.98
R2157:Vmn2r116	UTSW	17	23401469	missense	probably damaging	1.00
R3622:Vmn2r116	UTSW	17	23386051	missense	probably benign	0.11
R3690:Vmn2r116	UTSW	17	23384824	missense	unknown
R4298:Vmn2r116	UTSW	17	23401827	missense	possibly damaging	0.69
R4373:Vmn2r116	UTSW	17	23401421	missense	probably benign	0.01
R4860:Vmn2r116	UTSW	17	23401803	missense	probably benign
R4941:Vmn2r116	UTSW	17	23401142	missense	probably damaging	1.00
R5119:Vmn2r116	UTSW	17	23387164	missense	probably benign	0.01
R5503:Vmn2r116	UTSW	17	23386804	missense	probably benign	0.07
R5510:Vmn2r116	UTSW	17	23386121	missense	probably damaging	1.00
R5538:Vmn2r116	UTSW	17	23401067	missense	probably benign	0.00
R5689:Vmn2r116	UTSW	17	23397719	missense	probably benign	0.30
R5765:Vmn2r116	UTSW	17	23401404	missense	probably damaging	0.99
R5794:Vmn2r116	UTSW	17	23385968	missense	probably damaging	0.99
R5807:Vmn2r116	UTSW	17	23387307	missense	probably damaging	1.00
R5837:Vmn2r116	UTSW	17	23387080	missense	probably damaging	1.00
R6262:Vmn2r116	UTSW	17	23387377	missense	probably benign	0.03
R6298:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R6651:Vmn2r116	UTSW	17	23388831	nonsense	probably null
R6667:Vmn2r116	UTSW	17	23401092	missense	probably damaging	1.00
R7393:Vmn2r116	UTSW	17	23386125	missense	probably benign	0.14
R7571:Vmn2r116	UTSW	17	23384856	splice site	probably null
R7940:Vmn2r116	UTSW	17	23386972	missense	probably damaging	0.99
R8510:Vmn2r116	UTSW	17	23385931	nonsense	probably null
R8950:Vmn2r116	UTSW	17	23401493	missense	probably damaging	1.00
R8956:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R8977:Vmn2r116	UTSW	17	23386942	missense	possibly damaging	0.56
R9030:Vmn2r116	UTSW	17	23384890	missense	possibly damaging	0.82
R9077:Vmn2r116	UTSW	17	23385982	missense	probably benign	0.14
R9223:Vmn2r116	UTSW	17	23401167	missense	probably damaging	1.00
R9401:Vmn2r116	UTSW	17	23401592	missense	probably damaging	1.00
R9449:Vmn2r116	UTSW	17	23386945	missense	probably benign	0.01
R9746:Vmn2r116	UTSW	17	23401823	missense	probably benign	0.08
R9755:Vmn2r116	UTSW	17	23401091	missense	probably damaging	1.00
R9759:Vmn2r116	UTSW	17	23401386	missense	possibly damaging	0.90
R9800:Vmn2r116	UTSW	17	23401425	missense	probably damaging	0.97
S24628:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
Z1176:Vmn2r116	UTSW	17	23401428	missense	probably damaging	1.00
Z1177:Vmn2r116	UTSW	17	23388892	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGACAGATCATCATTGTATGCCACAAG -3'
(R):5'- ACTCCCGTAACTCTTAGAATGGATCAGG -3'

Sequencing Primer
(F):5'- TATGCCACAAGGGTTCAGTC -3'
(R):5'- GGAAGATTGTTTTTTTGAACATTGTG -3'

Posted On

2013-08-20