Incidental Mutation 'R8786:Phf2'
ID670655
Institutional Source Beutler Lab
Gene Symbol Phf2
Ensembl Gene ENSMUSG00000038025
Gene NamePHD finger protein 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R8786 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location48801750-48871119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48813743 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 712 (M712K)
Ref Sequence ENSEMBL: ENSMUSP00000047308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035540]
Predicted Effect unknown
Transcript: ENSMUST00000035540
AA Change: M712K
SMART Domains Protein: ENSMUSP00000047308
Gene: ENSMUSG00000038025
AA Change: M712K

DomainStartEndE-ValueType
PHD 7 54 1.08e-9 SMART
JmjC 197 353 1.98e-47 SMART
low complexity region 468 481 N/A INTRINSIC
low complexity region 487 532 N/A INTRINSIC
low complexity region 884 891 N/A INTRINSIC
coiled coil region 924 948 N/A INTRINSIC
low complexity region 953 1021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a zinc finger-like PHD (plant homeodomain) finger, distinct from other classes of zinc finger motifs, and a hydrophobic and highly conserved domain. The PHD finger shows the typical Cys4-His-Cys3 arrangement. PHD finger genes are thought to belong to a diverse group of transcriptional regulators possibly affecting eukaryotic gene expression by influencing chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased body weight, decreased adipocity and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C A 2: 118,757,251 S534I unknown Het
Adamtsl4 A T 3: 95,685,474 M1K probably null Het
Atg2a G T 19: 6,244,430 V59L probably damaging Het
Atxn7 C A 14: 14,103,316 T888K possibly damaging Het
BC055324 A T 1: 163,964,471 L626Q probably damaging Het
Btbd9 T C 17: 30,530,170 R57G probably damaging Het
Crp T C 1: 172,698,726 V126A probably benign Het
Csf1r A T 18: 61,114,870 T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 N299S probably damaging Het
Dcaf17 T C 2: 71,087,400 probably null Het
Dip2c A G 13: 9,615,794 D985G probably damaging Het
Dtna A G 18: 23,583,133 T138A probably benign Het
Emid1 T C 11: 5,131,517 D212G probably benign Het
Epyc G A 10: 97,675,663 D173N probably damaging Het
Fanci A G 7: 79,402,550 D162G probably benign Het
Fry T C 5: 150,394,036 V827A probably benign Het
Ggps1 T C 13: 14,053,920 E226G probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gopc G A 10: 52,354,654 R183* probably null Het
Grik4 C T 9: 42,541,834 G752S probably damaging Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
H2-Q1 T A 17: 35,320,893 V46D probably damaging Het
Hsd17b3 T C 13: 64,072,048 N126S probably damaging Het
Igsf10 G A 3: 59,330,642 T706I probably benign Het
Kmt2e A G 5: 23,464,866 D117G probably damaging Het
Krtap29-1 C T 11: 99,978,639 G139R probably damaging Het
Lama5 T C 2: 180,196,307 Y872C probably damaging Het
Lrriq4 T A 3: 30,650,603 M260K probably benign Het
Map2 G A 1: 66,433,596 probably benign Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mrpl51 C T 6: 125,192,377 A8V probably benign Het
Ndufs3 T C 2: 90,902,434 T103A probably benign Het
Numa1 T G 7: 101,998,409 L449R probably benign Het
Olfr1513 C T 14: 52,349,564 A161T possibly damaging Het
Pan3 C T 5: 147,488,141 P295S possibly damaging Het
Pds5b T C 5: 150,780,669 S846P probably damaging Het
Phlda2 A T 7: 143,502,474 V6E probably benign Het
Pkdrej C A 15: 85,819,843 A631S probably benign Het
Plcd3 G T 11: 103,071,743 N627K probably damaging Het
Prpf6 T C 2: 181,620,622 I138T possibly damaging Het
Psd4 G A 2: 24,405,432 S866N probably benign Het
Ptprb A C 10: 116,319,401 T400P probably benign Het
Rxfp1 T C 3: 79,663,370 probably null Het
Sbf2 A G 7: 110,464,586 probably null Het
Setd4 C T 16: 93,593,274 R89Q probably benign Het
Sgpp1 A G 12: 75,716,378 I343T probably benign Het
Sh2b2 T C 5: 136,231,804 D186G probably benign Het
Slc12a4 A T 8: 105,953,917 I191N probably damaging Het
Slc4a4 A T 5: 89,084,690 D251V probably benign Het
Slc6a5 A T 7: 49,912,095 D125V possibly damaging Het
Slf1 T A 13: 77,126,687 I16F possibly damaging Het
Sncaip T C 18: 52,898,262 V521A probably damaging Het
Stx19 T C 16: 62,822,412 L197P probably damaging Het
Sucla2 A G 14: 73,560,465 N39D probably benign Het
Sult1d1 T A 5: 87,564,716 T90S probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r138 A G 6: 40,612,677 S212P probably damaging Het
Tdrd3 T A 14: 87,472,201 C106* probably null Het
Tex43 T C 18: 56,594,496 F89L probably damaging Het
Tlk2 C T 11: 105,281,233 A743V unknown Het
Tlr3 T C 8: 45,398,249 D537G possibly damaging Het
Tmc1 A G 19: 20,826,589 Y375H probably damaging Het
Tsen54 T A 11: 115,820,672 M305K probably damaging Het
Umod C T 7: 119,477,358 V62M possibly damaging Het
Vmn1r10 A G 6: 57,114,025 T201A probably benign Het
Vmn1r103 T C 7: 20,509,751 T262A probably benign Het
Vmn2r100 T C 17: 19,522,576 V404A probably damaging Het
Vmn2r56 A G 7: 12,715,466 F282L probably damaging Het
Wdr64 A T 1: 175,808,761 K982* probably null Het
Other mutations in Phf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Phf2 APN 13 48819607 missense unknown
IGL01554:Phf2 APN 13 48805879 nonsense probably null
IGL02063:Phf2 APN 13 48821642 missense unknown
IGL02456:Phf2 APN 13 48828846 missense unknown
IGL02498:Phf2 APN 13 48805239 missense unknown
IGL02586:Phf2 APN 13 48813858 splice site probably benign
IGL02688:Phf2 APN 13 48805839 missense unknown
H8441:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
R0265:Phf2 UTSW 13 48828794 missense unknown
R0389:Phf2 UTSW 13 48804489 missense unknown
R0535:Phf2 UTSW 13 48813947 missense unknown
R1162:Phf2 UTSW 13 48819641 splice site probably benign
R1342:Phf2 UTSW 13 48804477 missense unknown
R1551:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R1551:Phf2 UTSW 13 48832103 missense unknown
R1567:Phf2 UTSW 13 48832113 missense unknown
R1698:Phf2 UTSW 13 48807630 missense unknown
R1766:Phf2 UTSW 13 48819557 missense unknown
R1785:Phf2 UTSW 13 48817567 missense unknown
R1997:Phf2 UTSW 13 48828908 missense unknown
R2034:Phf2 UTSW 13 48817730 missense unknown
R2096:Phf2 UTSW 13 48832113 nonsense probably null
R2147:Phf2 UTSW 13 48804689 missense unknown
R2149:Phf2 UTSW 13 48804689 missense unknown
R2154:Phf2 UTSW 13 48820073 missense unknown
R2296:Phf2 UTSW 13 48835278 missense unknown
R4212:Phf2 UTSW 13 48820613 missense unknown
R4749:Phf2 UTSW 13 48821709 splice site probably null
R4770:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R4948:Phf2 UTSW 13 48807722 missense unknown
R4989:Phf2 UTSW 13 48807844 missense unknown
R5792:Phf2 UTSW 13 48820042 splice site probably null
R5848:Phf2 UTSW 13 48820070 missense unknown
R6092:Phf2 UTSW 13 48816057 missense unknown
R6165:Phf2 UTSW 13 48813865 critical splice donor site probably null
R6192:Phf2 UTSW 13 48820107 missense unknown
R6237:Phf2 UTSW 13 48803655 nonsense probably null
R6249:Phf2 UTSW 13 48805872 missense unknown
R6489:Phf2 UTSW 13 48826182 missense unknown
R7616:Phf2 UTSW 13 48807607 missense unknown
R8058:Phf2 UTSW 13 48823082 missense unknown
R8158:Phf2 UTSW 13 48817760 missense probably benign 0.23
R8186:Phf2 UTSW 13 48807751 missense unknown
R8218:Phf2 UTSW 13 48804628 missense unknown
R8237:Phf2 UTSW 13 48823038 missense unknown
R8431:Phf2 UTSW 13 48821602 missense unknown
R8496:Phf2 UTSW 13 48817705 missense unknown
R8792:Phf2 UTSW 13 48817505 critical splice donor site probably benign
V1024:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
X0027:Phf2 UTSW 13 48832118 missense unknown
Z1176:Phf2 UTSW 13 48807707 missense unknown
Z1177:Phf2 UTSW 13 48804593 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGGAGCATCGCCTTAGCC -3'
(R):5'- GCGATGAGTATGAGTACGTATCAG -3'

Sequencing Primer
(F):5'- ATCGCCTTAGCCCTGGTG -3'
(R):5'- GCTGAAGATAGACGAGTTTCCCATC -3'
Posted On2021-04-30