Incidental Mutation 'R8786:Hsd17b3'
ID 670656
Institutional Source Beutler Lab
Gene Symbol Hsd17b3
Ensembl Gene ENSMUSG00000033122
Gene Name hydroxysteroid (17-beta) dehydrogenase 3
Synonyms 17(beta)HSD type 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8786 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 64058266-64089230 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64072048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 126 (N126S)
Ref Sequence ENSEMBL: ENSMUSP00000044217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039832] [ENSMUST00000166224] [ENSMUST00000222783] [ENSMUST00000222810]
AlphaFold P70385
Predicted Effect probably damaging
Transcript: ENSMUST00000039832
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122
AA Change: N126S

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166224
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122
AA Change: N126S

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000222783
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222810
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C A 2: 118,757,251 S534I unknown Het
Adamtsl4 A T 3: 95,685,474 M1K probably null Het
Atg2a G T 19: 6,244,430 V59L probably damaging Het
Atxn7 C A 14: 14,103,316 T888K possibly damaging Het
BC055324 A T 1: 163,964,471 L626Q probably damaging Het
Btbd9 T C 17: 30,530,170 R57G probably damaging Het
Catspere2 T A 1: 178,015,796 probably benign Het
Catspere2 G A 1: 178,015,989 probably benign Het
Crp T C 1: 172,698,726 V126A probably benign Het
Csf1r A T 18: 61,114,870 T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 N299S probably damaging Het
Dcaf17 T C 2: 71,087,400 probably null Het
Dip2c A G 13: 9,615,794 D985G probably damaging Het
Dtna A G 18: 23,583,133 T138A probably benign Het
Emid1 T C 11: 5,131,517 D212G probably benign Het
Epyc G A 10: 97,675,663 D173N probably damaging Het
Fanci A G 7: 79,402,550 D162G probably benign Het
Fry T C 5: 150,394,036 V827A probably benign Het
Ggps1 T C 13: 14,053,920 E226G probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gopc G A 10: 52,354,654 R183* probably null Het
Grik4 C T 9: 42,541,834 G752S probably damaging Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
H2-Q1 T A 17: 35,320,893 V46D probably damaging Het
Igsf10 G A 3: 59,330,642 T706I probably benign Het
Kmt2e A G 5: 23,464,866 D117G probably damaging Het
Kmt5a C T 5: 124,446,011 A18V probably benign Het
Krtap29-1 C T 11: 99,978,639 G139R probably damaging Het
Lama5 T C 2: 180,196,307 Y872C probably damaging Het
Lrriq4 T A 3: 30,650,603 M260K probably benign Het
Map2 G A 1: 66,433,596 probably benign Het
Mrpl51 C T 6: 125,192,377 A8V probably benign Het
Ndufs3 T C 2: 90,902,434 T103A probably benign Het
Numa1 T G 7: 101,998,409 L449R probably benign Het
Olfr1513 C T 14: 52,349,564 A161T possibly damaging Het
Pan3 C T 5: 147,488,141 P295S possibly damaging Het
Pds5b T C 5: 150,780,669 S846P probably damaging Het
Phf2 A T 13: 48,813,743 M712K unknown Het
Phlda2 A T 7: 143,502,474 V6E probably benign Het
Pkdrej C A 15: 85,819,843 A631S probably benign Het
Plcd3 G T 11: 103,071,743 N627K probably damaging Het
Prpf6 T C 2: 181,620,622 I138T possibly damaging Het
Psd4 G A 2: 24,405,432 S866N probably benign Het
Ptprb A C 10: 116,319,401 T400P probably benign Het
Rxfp1 T C 3: 79,663,370 probably null Het
Sbf2 A G 7: 110,464,586 probably null Het
Setd4 C T 16: 93,593,274 R89Q probably benign Het
Sgpp1 A G 12: 75,716,378 I343T probably benign Het
Sh2b2 T C 5: 136,231,804 D186G probably benign Het
Slc12a4 A T 8: 105,953,917 I191N probably damaging Het
Slc4a4 A T 5: 89,084,690 D251V probably benign Het
Slc6a5 A T 7: 49,912,095 D125V possibly damaging Het
Slf1 T A 13: 77,126,687 I16F possibly damaging Het
Sncaip T C 18: 52,898,262 V521A probably damaging Het
Stx19 T C 16: 62,822,412 L197P probably damaging Het
Sucla2 A G 14: 73,560,465 N39D probably benign Het
Sult1d1 T A 5: 87,564,716 T90S probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r138 A G 6: 40,612,677 S212P probably damaging Het
Tdrd3 T A 14: 87,472,201 C106* probably null Het
Tex43 T C 18: 56,594,496 F89L probably damaging Het
Tlk2 C T 11: 105,281,233 A743V unknown Het
Tlr3 T C 8: 45,398,249 D537G possibly damaging Het
Tmc1 A G 19: 20,826,589 Y375H probably damaging Het
Tsen54 T A 11: 115,820,672 M305K probably damaging Het
Umod C T 7: 119,477,358 V62M possibly damaging Het
Vmn1r10 A G 6: 57,114,025 T201A probably benign Het
Vmn1r103 T C 7: 20,509,751 T262A probably benign Het
Vmn2r100 T C 17: 19,522,576 V404A probably damaging Het
Vmn2r56 A G 7: 12,715,466 F282L probably damaging Het
Wdr64 A T 1: 175,808,761 K982* probably null Het
Xpo6 A T 7: 126,112,955 probably benign Het
Other mutations in Hsd17b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Hsd17b3 APN 13 64062905 missense probably damaging 1.00
IGL02221:Hsd17b3 APN 13 64089051 missense probably benign 0.01
IGL02257:Hsd17b3 APN 13 64059462 missense probably benign 0.14
IGL02745:Hsd17b3 APN 13 64087176 missense probably benign 0.01
IGL03189:Hsd17b3 APN 13 64063087 critical splice donor site probably null
hermine UTSW 13 64062906 missense probably damaging 1.00
IGL02988:Hsd17b3 UTSW 13 64089100 missense probably damaging 0.96
R0116:Hsd17b3 UTSW 13 64058589 missense possibly damaging 0.87
R0659:Hsd17b3 UTSW 13 64073936 missense possibly damaging 0.87
R0684:Hsd17b3 UTSW 13 64089068 missense probably benign
R0834:Hsd17b3 UTSW 13 64089122 missense probably benign 0.00
R3750:Hsd17b3 UTSW 13 64063179 splice site probably null
R3845:Hsd17b3 UTSW 13 64089062 missense possibly damaging 0.94
R3973:Hsd17b3 UTSW 13 64059486 missense probably damaging 1.00
R4602:Hsd17b3 UTSW 13 64063170 critical splice acceptor site probably null
R5027:Hsd17b3 UTSW 13 64062906 missense probably damaging 1.00
R5470:Hsd17b3 UTSW 13 64073899 missense probably damaging 1.00
R5897:Hsd17b3 UTSW 13 64088985 critical splice donor site probably null
R5992:Hsd17b3 UTSW 13 64059470 splice site probably null
R6898:Hsd17b3 UTSW 13 64059525 missense probably benign 0.06
R7297:Hsd17b3 UTSW 13 64076351 missense probably damaging 1.00
R7555:Hsd17b3 UTSW 13 64072002 missense probably benign 0.17
R8743:Hsd17b3 UTSW 13 64062898 missense probably benign 0.00
R8904:Hsd17b3 UTSW 13 64064380 missense probably damaging 1.00
R8994:Hsd17b3 UTSW 13 64062881 missense probably damaging 1.00
R9324:Hsd17b3 UTSW 13 64058645 missense possibly damaging 0.49
Z1176:Hsd17b3 UTSW 13 64063138 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCACCATGCAGCAGAGTCTG -3'
(R):5'- ACTGGGAATCAGACTTAGGTTCCC -3'

Sequencing Primer
(F):5'- AGAGTCTGGCCTGACCCAATTC -3'
(R):5'- GGAATCAGACTTAGGTTCCCATTTTG -3'
Posted On 2021-04-30