Incidental Mutation 'R8786:Setd4'
ID 670664
Institutional Source Beutler Lab
Gene Symbol Setd4
Ensembl Gene ENSMUSG00000022948
Gene Name SET domain containing 4
Synonyms ORF21
MMRRC Submission 068632-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8786 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 93380345-93400951 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 93390162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 89 (R89Q)
Ref Sequence ENSEMBL: ENSMUSP00000023669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023669]
AlphaFold P58467
Predicted Effect probably benign
Transcript: ENSMUST00000023669
AA Change: R89Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023669
Gene: ENSMUSG00000022948
AA Change: R89Q

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 3.2e-11 PFAM
Pfam:Rubis-subs-bind 306 424 5.5e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,592,784 (GRCm39) M1K probably null Het
Atg2a G T 19: 6,294,460 (GRCm39) V59L probably damaging Het
Atxn7 C A 14: 14,103,316 (GRCm38) T888K possibly damaging Het
Btbd9 T C 17: 30,749,144 (GRCm39) R57G probably damaging Het
Catspere2 T A 1: 177,843,362 (GRCm39) probably benign Het
Catspere2 G A 1: 177,843,555 (GRCm39) probably benign Het
Ccdc9b C A 2: 118,587,732 (GRCm39) S534I unknown Het
Crp T C 1: 172,526,293 (GRCm39) V126A probably benign Het
Csf1r A T 18: 61,247,942 (GRCm39) T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 (GRCm39) N299S probably damaging Het
Dcaf17 T C 2: 70,917,744 (GRCm39) probably null Het
Dip2c A G 13: 9,665,830 (GRCm39) D985G probably damaging Het
Dtna A G 18: 23,716,190 (GRCm39) T138A probably benign Het
Emid1 T C 11: 5,081,517 (GRCm39) D212G probably benign Het
Epyc G A 10: 97,511,525 (GRCm39) D173N probably damaging Het
Fanci A G 7: 79,052,298 (GRCm39) D162G probably benign Het
Firrm A T 1: 163,792,040 (GRCm39) L626Q probably damaging Het
Fry T C 5: 150,317,501 (GRCm39) V827A probably benign Het
Ggps1 T C 13: 14,228,505 (GRCm39) E226G probably benign Het
Gopc G A 10: 52,230,750 (GRCm39) R183* probably null Het
Grik4 C T 9: 42,453,130 (GRCm39) G752S probably damaging Het
H2-D1 T A 17: 35,482,844 (GRCm39) C125S probably damaging Het
H2-Q1 T A 17: 35,539,869 (GRCm39) V46D probably damaging Het
Hsd17b3 T C 13: 64,219,862 (GRCm39) N126S probably damaging Het
Igsf10 G A 3: 59,238,063 (GRCm39) T706I probably benign Het
Kmt2e A G 5: 23,669,864 (GRCm39) D117G probably damaging Het
Kmt5a C T 5: 124,584,074 (GRCm39) A18V probably benign Het
Krtap29-1 C T 11: 99,869,465 (GRCm39) G139R probably damaging Het
Lama5 T C 2: 179,838,100 (GRCm39) Y872C probably damaging Het
Lrriq4 T A 3: 30,704,752 (GRCm39) M260K probably benign Het
Map2 G A 1: 66,472,755 (GRCm39) probably benign Het
Mrpl51 C T 6: 125,169,340 (GRCm39) A8V probably benign Het
Ndufs3 T C 2: 90,732,778 (GRCm39) T103A probably benign Het
Numa1 T G 7: 101,647,616 (GRCm39) L449R probably benign Het
Or10g3b C T 14: 52,587,021 (GRCm39) A161T possibly damaging Het
Pan3 C T 5: 147,424,951 (GRCm39) P295S possibly damaging Het
Pds5b T C 5: 150,704,134 (GRCm39) S846P probably damaging Het
Phf2 A T 13: 48,967,219 (GRCm39) M712K unknown Het
Phlda2 A T 7: 143,056,211 (GRCm39) V6E probably benign Het
Pkdrej C A 15: 85,704,044 (GRCm39) A631S probably benign Het
Plcd3 G T 11: 102,962,569 (GRCm39) N627K probably damaging Het
Prpf6 T C 2: 181,262,415 (GRCm39) I138T possibly damaging Het
Psd4 G A 2: 24,295,444 (GRCm39) S866N probably benign Het
Ptprb A C 10: 116,155,306 (GRCm39) T400P probably benign Het
Rxfp1 T C 3: 79,570,677 (GRCm39) probably null Het
Sbf2 A G 7: 110,063,793 (GRCm39) probably null Het
Serpinb9h G A 13: 33,588,204 (GRCm39) R263H probably benign Het
Sgpp1 A G 12: 75,763,152 (GRCm39) I343T probably benign Het
Sh2b2 T C 5: 136,260,658 (GRCm39) D186G probably benign Het
Slc12a4 A T 8: 106,680,549 (GRCm39) I191N probably damaging Het
Slc4a4 A T 5: 89,232,549 (GRCm39) D251V probably benign Het
Slc6a5 A T 7: 49,561,843 (GRCm39) D125V possibly damaging Het
Slf1 T A 13: 77,274,806 (GRCm39) I16F possibly damaging Het
Sncaip T C 18: 53,031,334 (GRCm39) V521A probably damaging Het
Spmip10 T C 18: 56,727,568 (GRCm39) F89L probably damaging Het
Stx19 T C 16: 62,642,775 (GRCm39) L197P probably damaging Het
Sucla2 A G 14: 73,797,905 (GRCm39) N39D probably benign Het
Sult1d1 T A 5: 87,712,575 (GRCm39) T90S probably benign Het
Syna C T 5: 134,588,723 (GRCm39) M75I probably benign Het
Tas2r138 A G 6: 40,589,611 (GRCm39) S212P probably damaging Het
Tdrd3 T A 14: 87,709,637 (GRCm39) C106* probably null Het
Tlk2 C T 11: 105,172,059 (GRCm39) A743V unknown Het
Tlr3 T C 8: 45,851,286 (GRCm39) D537G possibly damaging Het
Tmc1 A G 19: 20,803,953 (GRCm39) Y375H probably damaging Het
Tsen54 T A 11: 115,711,498 (GRCm39) M305K probably damaging Het
Umod C T 7: 119,076,581 (GRCm39) V62M possibly damaging Het
Vmn1r10 A G 6: 57,091,010 (GRCm39) T201A probably benign Het
Vmn1r103 T C 7: 20,243,676 (GRCm39) T262A probably benign Het
Vmn2r100 T C 17: 19,742,838 (GRCm39) V404A probably damaging Het
Vmn2r56 A G 7: 12,449,393 (GRCm39) F282L probably damaging Het
Wdr64 A T 1: 175,636,327 (GRCm39) K982* probably null Het
Xpo6 A T 7: 125,712,127 (GRCm39) probably benign Het
Other mutations in Setd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Setd4 APN 16 93,388,127 (GRCm39) missense probably damaging 1.00
IGL02217:Setd4 APN 16 93,390,183 (GRCm39) missense probably damaging 1.00
R0370:Setd4 UTSW 16 93,388,006 (GRCm39) missense probably damaging 0.99
R0573:Setd4 UTSW 16 93,386,834 (GRCm39) missense probably benign
R1103:Setd4 UTSW 16 93,382,082 (GRCm39) missense probably benign 0.01
R1631:Setd4 UTSW 16 93,390,136 (GRCm39) nonsense probably null
R1826:Setd4 UTSW 16 93,388,187 (GRCm39) nonsense probably null
R2356:Setd4 UTSW 16 93,387,871 (GRCm39) missense probably damaging 1.00
R2360:Setd4 UTSW 16 93,383,122 (GRCm39) splice site probably benign
R4362:Setd4 UTSW 16 93,380,574 (GRCm39) splice site probably null
R4630:Setd4 UTSW 16 93,388,114 (GRCm39) missense probably benign 0.00
R4823:Setd4 UTSW 16 93,386,838 (GRCm39) missense probably benign 0.00
R5004:Setd4 UTSW 16 93,388,133 (GRCm39) missense probably benign 0.02
R5257:Setd4 UTSW 16 93,393,221 (GRCm39) missense probably damaging 0.98
R6667:Setd4 UTSW 16 93,386,918 (GRCm39) missense probably benign 0.16
R6798:Setd4 UTSW 16 93,386,841 (GRCm39) missense probably damaging 1.00
R7296:Setd4 UTSW 16 93,380,830 (GRCm39) splice site probably null
R7313:Setd4 UTSW 16 93,388,132 (GRCm39) missense probably benign 0.09
R7314:Setd4 UTSW 16 93,384,711 (GRCm39) missense probably benign 0.13
R8866:Setd4 UTSW 16 93,386,961 (GRCm39) missense probably damaging 0.97
R9153:Setd4 UTSW 16 93,384,722 (GRCm39) missense possibly damaging 0.96
R9363:Setd4 UTSW 16 93,388,009 (GRCm39) missense probably benign 0.08
R9627:Setd4 UTSW 16 93,380,562 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGAACCAAGAACAACCCTGGAAG -3'
(R):5'- TCTGAGTTTTGTTGAATGCAATGAAA -3'

Sequencing Primer
(F):5'- CTGGAAGAGAATAAACCTTCAATCG -3'
(R):5'- TTCCATTGCAACAGAGGCTG -3'
Posted On 2021-04-30