Incidental Mutation 'R8786:Btbd9'
ID670666
Institutional Source Beutler Lab
Gene Symbol Btbd9
Ensembl Gene ENSMUSG00000062202
Gene NameBTB (POZ) domain containing 9
Synonyms1700023F20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8786 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location30215524-30576287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30530170 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 57 (R57G)
Ref Sequence ENSEMBL: ENSMUSP00000078845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]
Predicted Effect probably damaging
Transcript: ENSMUST00000079924
AA Change: R57G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: R57G

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 283 405 3.9e-11 PFAM
Pfam:F5_F8_type_C 431 554 6.3e-12 PFAM
low complexity region 585 612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168787
AA Change: R57G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: R57G

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 278 405 1.1e-8 PFAM
Pfam:F5_F8_type_C 433 554 1.4e-8 PFAM
low complexity region 585 612 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C A 2: 118,757,251 S534I unknown Het
Adamtsl4 A T 3: 95,685,474 M1K probably null Het
Atg2a G T 19: 6,244,430 V59L probably damaging Het
Atxn7 C A 14: 14,103,316 T888K possibly damaging Het
BC055324 A T 1: 163,964,471 L626Q probably damaging Het
Crp T C 1: 172,698,726 V126A probably benign Het
Csf1r A T 18: 61,114,870 T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 N299S probably damaging Het
Dcaf17 T C 2: 71,087,400 probably null Het
Dip2c A G 13: 9,615,794 D985G probably damaging Het
Dtna A G 18: 23,583,133 T138A probably benign Het
Emid1 T C 11: 5,131,517 D212G probably benign Het
Epyc G A 10: 97,675,663 D173N probably damaging Het
Fanci A G 7: 79,402,550 D162G probably benign Het
Fry T C 5: 150,394,036 V827A probably benign Het
Ggps1 T C 13: 14,053,920 E226G probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gopc G A 10: 52,354,654 R183* probably null Het
Grik4 C T 9: 42,541,834 G752S probably damaging Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
H2-Q1 T A 17: 35,320,893 V46D probably damaging Het
Hsd17b3 T C 13: 64,072,048 N126S probably damaging Het
Igsf10 G A 3: 59,330,642 T706I probably benign Het
Kmt2e A G 5: 23,464,866 D117G probably damaging Het
Krtap29-1 C T 11: 99,978,639 G139R probably damaging Het
Lama5 T C 2: 180,196,307 Y872C probably damaging Het
Lrriq4 T A 3: 30,650,603 M260K probably benign Het
Map2 G A 1: 66,433,596 probably benign Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mrpl51 C T 6: 125,192,377 A8V probably benign Het
Ndufs3 T C 2: 90,902,434 T103A probably benign Het
Numa1 T G 7: 101,998,409 L449R probably benign Het
Olfr1513 C T 14: 52,349,564 A161T possibly damaging Het
Pan3 C T 5: 147,488,141 P295S possibly damaging Het
Pds5b T C 5: 150,780,669 S846P probably damaging Het
Phf2 A T 13: 48,813,743 M712K unknown Het
Phlda2 A T 7: 143,502,474 V6E probably benign Het
Pkdrej C A 15: 85,819,843 A631S probably benign Het
Plcd3 G T 11: 103,071,743 N627K probably damaging Het
Prpf6 T C 2: 181,620,622 I138T possibly damaging Het
Psd4 G A 2: 24,405,432 S866N probably benign Het
Ptprb A C 10: 116,319,401 T400P probably benign Het
Rxfp1 T C 3: 79,663,370 probably null Het
Sbf2 A G 7: 110,464,586 probably null Het
Setd4 C T 16: 93,593,274 R89Q probably benign Het
Sgpp1 A G 12: 75,716,378 I343T probably benign Het
Sh2b2 T C 5: 136,231,804 D186G probably benign Het
Slc12a4 A T 8: 105,953,917 I191N probably damaging Het
Slc4a4 A T 5: 89,084,690 D251V probably benign Het
Slc6a5 A T 7: 49,912,095 D125V possibly damaging Het
Slf1 T A 13: 77,126,687 I16F possibly damaging Het
Sncaip T C 18: 52,898,262 V521A probably damaging Het
Stx19 T C 16: 62,822,412 L197P probably damaging Het
Sucla2 A G 14: 73,560,465 N39D probably benign Het
Sult1d1 T A 5: 87,564,716 T90S probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r138 A G 6: 40,612,677 S212P probably damaging Het
Tdrd3 T A 14: 87,472,201 C106* probably null Het
Tex43 T C 18: 56,594,496 F89L probably damaging Het
Tlk2 C T 11: 105,281,233 A743V unknown Het
Tlr3 T C 8: 45,398,249 D537G possibly damaging Het
Tmc1 A G 19: 20,826,589 Y375H probably damaging Het
Tsen54 T A 11: 115,820,672 M305K probably damaging Het
Umod C T 7: 119,477,358 V62M possibly damaging Het
Vmn1r10 A G 6: 57,114,025 T201A probably benign Het
Vmn1r103 T C 7: 20,509,751 T262A probably benign Het
Vmn2r100 T C 17: 19,522,576 V404A probably damaging Het
Vmn2r56 A G 7: 12,715,466 F282L probably damaging Het
Wdr64 A T 1: 175,808,761 K982* probably null Het
Other mutations in Btbd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd9 APN 17 30299601 missense possibly damaging 0.71
IGL01651:Btbd9 APN 17 30220417 missense unknown
IGL01814:Btbd9 APN 17 30299535 missense probably benign 0.01
IGL01820:Btbd9 APN 17 30527409 missense possibly damaging 0.82
IGL02014:Btbd9 APN 17 30517150 missense probably damaging 0.98
IGL02075:Btbd9 APN 17 30274936 nonsense probably null
IGL02390:Btbd9 APN 17 30524814 missense probably benign 0.22
IGL02414:Btbd9 APN 17 30220559 missense possibly damaging 0.95
IGL02748:Btbd9 APN 17 30334297 missense possibly damaging 0.81
crumbs UTSW 17 30299736 splice site probably null
grain UTSW 17 30274942 missense possibly damaging 0.92
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0122:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0123:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0134:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0189:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0190:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0226:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0268:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0344:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0427:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0462:Btbd9 UTSW 17 30530217 missense possibly damaging 0.82
R0645:Btbd9 UTSW 17 30524967 missense probably damaging 0.96
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0974:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R1061:Btbd9 UTSW 17 30527435 missense probably benign 0.00
R1763:Btbd9 UTSW 17 30334297 missense possibly damaging 0.81
R1781:Btbd9 UTSW 17 30513593 missense probably damaging 1.00
R1902:Btbd9 UTSW 17 30530228 missense probably damaging 0.98
R1995:Btbd9 UTSW 17 30274930 missense possibly damaging 0.93
R2224:Btbd9 UTSW 17 30527346 missense probably damaging 0.98
R2237:Btbd9 UTSW 17 30334328 missense probably benign
R3684:Btbd9 UTSW 17 30334307 missense probably damaging 0.99
R3800:Btbd9 UTSW 17 30513659 missense possibly damaging 0.89
R4403:Btbd9 UTSW 17 30485932 intron probably benign
R4492:Btbd9 UTSW 17 30527571 missense probably damaging 0.99
R4654:Btbd9 UTSW 17 30485587 intron probably benign
R4854:Btbd9 UTSW 17 30524865 missense probably damaging 0.98
R5710:Btbd9 UTSW 17 30228868 missense probably benign 0.16
R5963:Btbd9 UTSW 17 30334218 splice site probably null
R6295:Btbd9 UTSW 17 30299736 splice site probably null
R6422:Btbd9 UTSW 17 30530256 missense probably benign
R7023:Btbd9 UTSW 17 30527572 missense probably benign 0.02
R7826:Btbd9 UTSW 17 30334327 missense probably benign 0.42
R7922:Btbd9 UTSW 17 30274884 missense probably benign 0.01
R7962:Btbd9 UTSW 17 30517203 missense probably damaging 0.99
R8265:Btbd9 UTSW 17 30334304 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTCCTTCAGACATCACGCAC -3'
(R):5'- GAGTAACAGCCACCCTCTTC -3'

Sequencing Primer
(F):5'- GCACAAAGAGTTAATTGGTGCTGTC -3'
(R):5'- CGCCCCTTTACTGCAGTGG -3'
Posted On2021-04-30