Incidental Mutation 'R8786:Tmc1'
ID670675
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Nametransmembrane channel-like gene family 1
Synonyms4933416G09Rik, Beethoven, Bth
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8786 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location20783458-20954202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20826589 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 375 (Y375H)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
Predicted Effect probably damaging
Transcript: ENSMUST00000039500
AA Change: Y375H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: Y375H

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C A 2: 118,757,251 S534I unknown Het
Adamtsl4 A T 3: 95,685,474 M1K probably null Het
Atg2a G T 19: 6,244,430 V59L probably damaging Het
Atxn7 C A 14: 14,103,316 T888K possibly damaging Het
BC055324 A T 1: 163,964,471 L626Q probably damaging Het
Btbd9 T C 17: 30,530,170 R57G probably damaging Het
Crp T C 1: 172,698,726 V126A probably benign Het
Csf1r A T 18: 61,114,870 T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 N299S probably damaging Het
Dcaf17 T C 2: 71,087,400 probably null Het
Dip2c A G 13: 9,615,794 D985G probably damaging Het
Dtna A G 18: 23,583,133 T138A probably benign Het
Emid1 T C 11: 5,131,517 D212G probably benign Het
Epyc G A 10: 97,675,663 D173N probably damaging Het
Fanci A G 7: 79,402,550 D162G probably benign Het
Fry T C 5: 150,394,036 V827A probably benign Het
Ggps1 T C 13: 14,053,920 E226G probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gopc G A 10: 52,354,654 R183* probably null Het
Grik4 C T 9: 42,541,834 G752S probably damaging Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
H2-Q1 T A 17: 35,320,893 V46D probably damaging Het
Hsd17b3 T C 13: 64,072,048 N126S probably damaging Het
Igsf10 G A 3: 59,330,642 T706I probably benign Het
Kmt2e A G 5: 23,464,866 D117G probably damaging Het
Krtap29-1 C T 11: 99,978,639 G139R probably damaging Het
Lama5 T C 2: 180,196,307 Y872C probably damaging Het
Lrriq4 T A 3: 30,650,603 M260K probably benign Het
Map2 G A 1: 66,433,596 probably benign Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mrpl51 C T 6: 125,192,377 A8V probably benign Het
Ndufs3 T C 2: 90,902,434 T103A probably benign Het
Numa1 T G 7: 101,998,409 L449R probably benign Het
Olfr1513 C T 14: 52,349,564 A161T possibly damaging Het
Pan3 C T 5: 147,488,141 P295S possibly damaging Het
Pds5b T C 5: 150,780,669 S846P probably damaging Het
Phf2 A T 13: 48,813,743 M712K unknown Het
Phlda2 A T 7: 143,502,474 V6E probably benign Het
Pkdrej C A 15: 85,819,843 A631S probably benign Het
Plcd3 G T 11: 103,071,743 N627K probably damaging Het
Prpf6 T C 2: 181,620,622 I138T possibly damaging Het
Psd4 G A 2: 24,405,432 S866N probably benign Het
Ptprb A C 10: 116,319,401 T400P probably benign Het
Rxfp1 T C 3: 79,663,370 probably null Het
Sbf2 A G 7: 110,464,586 probably null Het
Setd4 C T 16: 93,593,274 R89Q probably benign Het
Sgpp1 A G 12: 75,716,378 I343T probably benign Het
Sh2b2 T C 5: 136,231,804 D186G probably benign Het
Slc12a4 A T 8: 105,953,917 I191N probably damaging Het
Slc4a4 A T 5: 89,084,690 D251V probably benign Het
Slc6a5 A T 7: 49,912,095 D125V possibly damaging Het
Slf1 T A 13: 77,126,687 I16F possibly damaging Het
Sncaip T C 18: 52,898,262 V521A probably damaging Het
Stx19 T C 16: 62,822,412 L197P probably damaging Het
Sucla2 A G 14: 73,560,465 N39D probably benign Het
Sult1d1 T A 5: 87,564,716 T90S probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r138 A G 6: 40,612,677 S212P probably damaging Het
Tdrd3 T A 14: 87,472,201 C106* probably null Het
Tex43 T C 18: 56,594,496 F89L probably damaging Het
Tlk2 C T 11: 105,281,233 A743V unknown Het
Tlr3 T C 8: 45,398,249 D537G possibly damaging Het
Tsen54 T A 11: 115,820,672 M305K probably damaging Het
Umod C T 7: 119,477,358 V62M possibly damaging Het
Vmn1r10 A G 6: 57,114,025 T201A probably benign Het
Vmn1r103 T C 7: 20,509,751 T262A probably benign Het
Vmn2r100 T C 17: 19,522,576 V404A probably damaging Het
Vmn2r56 A G 7: 12,715,466 F282L probably damaging Het
Wdr64 A T 1: 175,808,761 K982* probably null Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20804645 missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20868361 missense probably benign 0.08
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATCCTTGTCTCACACTCAG -3'
(R):5'- CGGAATGCACTTTACGGAATTTC -3'

Sequencing Primer
(F):5'- TTGTCTCACACTCAGCTACAGAAG -3'
(R):5'- GCACTTTACGGAATTTCAGATTTTAG -3'
Posted On2021-04-30