Incidental Mutation 'R8787:Hadh'
ID670689
Institutional Source Beutler Lab
Gene Symbol Hadh
Ensembl Gene ENSMUSG00000027984
Gene Namehydroxyacyl-Coenzyme A dehydrogenase
SynonymsHadhsc, Schad
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8787 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location131233419-131272101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131234176 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 313 (Y313F)
Ref Sequence ENSEMBL: ENSMUSP00000029610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029610]
Predicted Effect probably damaging
Transcript: ENSMUST00000029610
AA Change: Y313F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029610
Gene: ENSMUSG00000027984
AA Change: Y313F

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 4 87 1.2e-7 PFAM
Pfam:3HCDH_N 29 214 1.4e-66 PFAM
Pfam:3HCDH 216 313 7e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the 3-hydroxyacyl-CoA dehydrogenase gene family. The encoded protein functions in the mitochondrial matrix to catalyze the oxidation of straight-chain 3-hydroxyacyl-CoAs as part of the beta-oxidation pathway. Its enzymatic activity is highest with medium-chain-length fatty acids. Mutations in this gene cause one form of familial hyperinsulinemic hypoglycemia. The human genome contains a related pseudogene of this gene on chromosome 15. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to diet-induced obesity associated with impaired fatty acid oxidation, impaired fat tolerance, decreased ketone bodies, and increased glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,275,053 H511Y possibly damaging Het
Acp5 G A 9: 22,127,193 R271* probably null Het
Adamts20 A T 15: 94,286,413 V1503E possibly damaging Het
Adra2b A T 2: 127,364,497 E311D probably benign Het
Aldh18a1 T C 19: 40,557,786 I556V possibly damaging Het
Alox12 C A 11: 70,253,320 A116S probably benign Het
Alox5 G T 6: 116,413,141 A552E probably damaging Het
Angpt1 G T 15: 42,512,384 L159I probably damaging Het
Atp2b4 CTT CTTTTT 1: 133,701,747 probably benign Het
Bub1b T A 2: 118,631,824 L726I probably damaging Het
Ccdc78 A T 17: 25,787,833 T165S probably benign Het
Ccdc88b T C 19: 6,847,423 D1323G probably damaging Het
Chek1 A T 9: 36,713,737 C349* probably null Het
Clec1a A T 6: 129,451,654 L21Q possibly damaging Het
Col1a1 T C 11: 94,942,808 V445A possibly damaging Het
Efcab7 A G 4: 99,900,594 T313A probably null Het
Fads1 T A 19: 10,192,961 Y288* probably null Het
Fgb T A 3: 83,046,662 T90S probably benign Het
Glg1 C A 8: 111,161,482 V1026L probably damaging Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gm30302 T C 13: 49,785,228 Y1002C probably damaging Het
Htr4 A G 18: 62,437,782 I303V possibly damaging Het
Kcnn3 A G 3: 89,645,450 D487G possibly damaging Het
L1td1 G A 4: 98,737,577 V604I probably benign Het
Lao1 A G 4: 118,968,368 T462A probably damaging Het
Lefty1 C A 1: 180,936,553 A86E probably damaging Het
Lmx1b T C 2: 33,639,510 Y79C Het
Lrp2 A G 2: 69,552,401 C47R probably damaging Het
Mrc2 A T 11: 105,347,639 N1204I probably benign Het
Ncf1 A C 5: 134,225,291 Y209* probably null Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr128 T A 17: 37,924,184 M206K probably benign Het
Olfr1368 A T 13: 21,142,283 M258K possibly damaging Het
Pcdhac1 T C 18: 37,091,889 V585A probably damaging Het
Pdcd11 T G 19: 47,108,580 L755R probably damaging Het
Pkhd1 A G 1: 20,288,237 V2705A probably damaging Het
Plch2 C A 4: 154,986,418 G1168V probably benign Het
Prpf39 T C 12: 65,042,781 Y98H possibly damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf10 T A 7: 112,955,531 D446E probably benign Het
Rgs13 T C 1: 144,140,744 Y87C probably damaging Het
Smpd3 G A 8: 106,255,745 R576C probably damaging Het
Srsf11 A T 3: 158,012,400 D382E unknown Het
Stpg1 T A 4: 135,533,797 M306K probably benign Het
Svil C T 18: 5,059,332 Q696* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Synj2 T C 17: 5,986,239 F161S possibly damaging Het
Tek T C 4: 94,849,800 Y696H probably damaging Het
Tgfbr1 A T 4: 47,405,555 D386V possibly damaging Het
Tgm4 G T 9: 123,061,845 G503V probably damaging Het
Tnni3k T C 3: 154,940,054 E461G probably damaging Het
Tom1l1 A T 11: 90,671,105 H232Q probably benign Het
Ubqln5 T C 7: 104,129,122 N165S probably benign Het
Vmn1r24 G A 6: 57,955,973 L187F probably benign Het
Vmn2r82 C T 10: 79,378,060 T160I probably damaging Het
Vmn2r96 G T 17: 18,597,988 G801V probably damaging Het
Vps39 A G 2: 120,342,025 S176P probably damaging Het
Vsig10 C A 5: 117,334,916 H191Q probably benign Het
Wtap G A 17: 12,967,601 S353L possibly damaging Het
Zmym4 T G 4: 126,923,160 R248S probably benign Het
Zscan10 A G 17: 23,610,037 S518G probably benign Het
Zscan29 A T 2: 121,166,395 Y282N probably damaging Het
Other mutations in Hadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Hadh APN 3 131249816 missense probably benign
IGL01062:Hadh APN 3 131240991 missense probably damaging 1.00
IGL01106:Hadh APN 3 131240970 missense possibly damaging 0.89
IGL02629:Hadh APN 3 131235635 missense probably damaging 1.00
IGL02717:Hadh APN 3 131249910 missense probably benign
IGL03180:Hadh APN 3 131271884 missense probably benign 0.08
IGL03240:Hadh APN 3 131248543 missense probably benign
R0081:Hadh UTSW 3 131235636 missense probably damaging 1.00
R1687:Hadh UTSW 3 131245249 missense probably benign 0.00
R2000:Hadh UTSW 3 131245239 missense probably benign 0.11
R4989:Hadh UTSW 3 131235548 nonsense probably null
R6851:Hadh UTSW 3 131271971 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTCAGTGGAAGAACCCCATG -3'
(R):5'- CAATGTTGGCTGTACCCGTG -3'

Sequencing Primer
(F):5'- GTGGAAGAACCCCATGACTGC -3'
(R):5'- ATGGATTCTGTGCCCCAGG -3'
Posted On2021-04-30