Incidental Mutation 'R8787:Smpd3'
ID670708
Institutional Source Beutler Lab
Gene Symbol Smpd3
Ensembl Gene ENSMUSG00000031906
Gene Namesphingomyelin phosphodiesterase 3, neutral
Synonymsneutral sphingomyelinase II, nSMase2, fro, 4631433G07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R8787 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location106252548-106337988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106255745 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 576 (R576C)
Ref Sequence ENSEMBL: ENSMUSP00000069255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067512] [ENSMUST00000071592] [ENSMUST00000212896]
Predicted Effect probably damaging
Transcript: ENSMUST00000067512
AA Change: R576C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069255
Gene: ENSMUSG00000031906
AA Change: R576C

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Pfam:Exo_endo_phos 321 639 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071592
SMART Domains Protein: ENSMUSP00000071521
Gene: ENSMUSG00000060098

DomainStartEndE-ValueType
Pfam:PrmA 53 148 1.6e-7 PFAM
internal_repeat_1 382 652 1.71e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000212896
AA Change: R576C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit dwarfism, delayed sexual and gonad maturation, delayed ossification of the long bones, and reduced serum levels of thyroxine, triiodothyronine, cortisol, and insulin-like growth factor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,275,053 H511Y possibly damaging Het
Acp5 G A 9: 22,127,193 R271* probably null Het
Adamts20 A T 15: 94,286,413 V1503E possibly damaging Het
Adra2b A T 2: 127,364,497 E311D probably benign Het
Aldh18a1 T C 19: 40,557,786 I556V possibly damaging Het
Alox12 C A 11: 70,253,320 A116S probably benign Het
Alox5 G T 6: 116,413,141 A552E probably damaging Het
Angpt1 G T 15: 42,512,384 L159I probably damaging Het
Atp2b4 CTT CTTTTT 1: 133,701,747 probably benign Het
Bub1b T A 2: 118,631,824 L726I probably damaging Het
Ccdc78 A T 17: 25,787,833 T165S probably benign Het
Ccdc88b T C 19: 6,847,423 D1323G probably damaging Het
Chek1 A T 9: 36,713,737 C349* probably null Het
Clec1a A T 6: 129,451,654 L21Q possibly damaging Het
Col1a1 T C 11: 94,942,808 V445A possibly damaging Het
Efcab7 A G 4: 99,900,594 T313A probably null Het
Fads1 T A 19: 10,192,961 Y288* probably null Het
Fgb T A 3: 83,046,662 T90S probably benign Het
Glg1 C A 8: 111,161,482 V1026L probably damaging Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gm30302 T C 13: 49,785,228 Y1002C probably damaging Het
Hadh T A 3: 131,234,176 Y313F probably damaging Het
Htr4 A G 18: 62,437,782 I303V possibly damaging Het
Kcnn3 A G 3: 89,645,450 D487G possibly damaging Het
L1td1 G A 4: 98,737,577 V604I probably benign Het
Lao1 A G 4: 118,968,368 T462A probably damaging Het
Lefty1 C A 1: 180,936,553 A86E probably damaging Het
Lmx1b T C 2: 33,639,510 Y79C Het
Lrp2 A G 2: 69,552,401 C47R probably damaging Het
Mrc2 A T 11: 105,347,639 N1204I probably benign Het
Ncf1 A C 5: 134,225,291 Y209* probably null Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr128 T A 17: 37,924,184 M206K probably benign Het
Olfr1368 A T 13: 21,142,283 M258K possibly damaging Het
Pcdhac1 T C 18: 37,091,889 V585A probably damaging Het
Pdcd11 T G 19: 47,108,580 L755R probably damaging Het
Pkhd1 A G 1: 20,288,237 V2705A probably damaging Het
Plch2 C A 4: 154,986,418 G1168V probably benign Het
Prpf39 T C 12: 65,042,781 Y98H possibly damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf10 T A 7: 112,955,531 D446E probably benign Het
Rgs13 T C 1: 144,140,744 Y87C probably damaging Het
Srsf11 A T 3: 158,012,400 D382E unknown Het
Stpg1 T A 4: 135,533,797 M306K probably benign Het
Svil C T 18: 5,059,332 Q696* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Synj2 T C 17: 5,986,239 F161S possibly damaging Het
Tek T C 4: 94,849,800 Y696H probably damaging Het
Tgfbr1 A T 4: 47,405,555 D386V possibly damaging Het
Tgm4 G T 9: 123,061,845 G503V probably damaging Het
Tnni3k T C 3: 154,940,054 E461G probably damaging Het
Tom1l1 A T 11: 90,671,105 H232Q probably benign Het
Ubqln5 T C 7: 104,129,122 N165S probably benign Het
Vmn1r24 G A 6: 57,955,973 L187F probably benign Het
Vmn2r82 C T 10: 79,378,060 T160I probably damaging Het
Vmn2r96 G T 17: 18,597,988 G801V probably damaging Het
Vps39 A G 2: 120,342,025 S176P probably damaging Het
Vsig10 C A 5: 117,334,916 H191Q probably benign Het
Wtap G A 17: 12,967,601 S353L possibly damaging Het
Zmym4 T G 4: 126,923,160 R248S probably benign Het
Zscan10 A G 17: 23,610,037 S518G probably benign Het
Zscan29 A T 2: 121,166,395 Y282N probably damaging Het
Other mutations in Smpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03380:Smpd3 APN 8 106259659 missense probably benign 0.01
BB010:Smpd3 UTSW 8 106255622 missense probably benign
BB020:Smpd3 UTSW 8 106255622 missense probably benign
G1citation:Smpd3 UTSW 8 106265964 start gained probably benign
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0456:Smpd3 UTSW 8 106259656 missense probably benign
R0759:Smpd3 UTSW 8 106265228 missense probably benign 0.34
R0799:Smpd3 UTSW 8 106264789 missense possibly damaging 0.92
R1544:Smpd3 UTSW 8 106265567 missense possibly damaging 0.70
R1756:Smpd3 UTSW 8 106264971 missense probably benign
R2937:Smpd3 UTSW 8 106264820 missense probably damaging 1.00
R2939:Smpd3 UTSW 8 106257407 missense probably benign 0.00
R4614:Smpd3 UTSW 8 106259739 missense probably damaging 1.00
R5829:Smpd3 UTSW 8 106264880 missense probably benign 0.15
R6822:Smpd3 UTSW 8 106265964 start gained probably benign
R6891:Smpd3 UTSW 8 106264668 missense probably damaging 1.00
R6962:Smpd3 UTSW 8 106265219 missense probably benign 0.34
R6965:Smpd3 UTSW 8 106259881 missense probably damaging 1.00
R7344:Smpd3 UTSW 8 106265193 missense probably damaging 1.00
R7394:Smpd3 UTSW 8 106265010 missense probably damaging 0.99
R7823:Smpd3 UTSW 8 106255622 missense probably benign
R7825:Smpd3 UTSW 8 106255622 missense probably benign
R7933:Smpd3 UTSW 8 106255622 missense probably benign
R7974:Smpd3 UTSW 8 106255622 missense probably benign
R7975:Smpd3 UTSW 8 106255622 missense probably benign
R7976:Smpd3 UTSW 8 106255622 missense probably benign
R7977:Smpd3 UTSW 8 106259894 missense probably benign 0.11
R7987:Smpd3 UTSW 8 106259894 missense probably benign 0.11
R8260:Smpd3 UTSW 8 106257415 missense probably benign 0.13
R8264:Smpd3 UTSW 8 106264658 missense probably damaging 1.00
R8292:Smpd3 UTSW 8 106264790 missense probably benign 0.08
R8432:Smpd3 UTSW 8 106257677 critical splice acceptor site probably null
R8494:Smpd3 UTSW 8 106255350 missense probably damaging 0.99
R8779:Smpd3 UTSW 8 106265489 missense probably benign 0.37
Z1177:Smpd3 UTSW 8 106264842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTATACATGGCTGCGGGC -3'
(R):5'- AAACTGGCTAGCCTGAGGTG -3'

Sequencing Primer
(F):5'- GGCCCAGCCTCACACTC -3'
(R):5'- AGATGGATAGTGGAAGGCCTCTTC -3'
Posted On2021-04-30