Incidental Mutation 'R8787:Glg1'
ID 670709
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Name golgi apparatus protein 1
Synonyms Selel, CFR, MG-160, CFR-1, ESL-1, MG160
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock # R8787 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 111154421-111259216 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 111161482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1026 (V1026L)
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
AlphaFold Q61543
Predicted Effect probably damaging
Transcript: ENSMUST00000003404
AA Change: V1015L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: V1015L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168741
AA Change: V419L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316
AA Change: V419L

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169020
AA Change: V1026L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: V1026L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,275,053 H511Y possibly damaging Het
Acp5 G A 9: 22,127,193 R271* probably null Het
Adamts20 A T 15: 94,286,413 V1503E possibly damaging Het
Adra2b A T 2: 127,364,497 E311D probably benign Het
Aldh18a1 T C 19: 40,557,786 I556V possibly damaging Het
Alox12 C A 11: 70,253,320 A116S probably benign Het
Alox5 G T 6: 116,413,141 A552E probably damaging Het
Angpt1 G T 15: 42,512,384 L159I probably damaging Het
Atp2b4 CTT CTTTTT 1: 133,701,747 probably benign Het
Bub1b T A 2: 118,631,824 L726I probably damaging Het
Ccdc78 A T 17: 25,787,833 T165S probably benign Het
Ccdc88b T C 19: 6,847,423 D1323G probably damaging Het
Chek1 A T 9: 36,713,737 C349* probably null Het
Clec1a A T 6: 129,451,654 L21Q possibly damaging Het
Col1a1 T C 11: 94,942,808 V445A possibly damaging Het
Efcab7 A G 4: 99,900,594 T313A probably null Het
Fads1 T A 19: 10,192,961 Y288* probably null Het
Fgb T A 3: 83,046,662 T90S probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gm30302 T C 13: 49,785,228 Y1002C probably damaging Het
Hadh T A 3: 131,234,176 Y313F probably damaging Het
Htr4 A G 18: 62,437,782 I303V possibly damaging Het
Kcnn3 A G 3: 89,645,450 D487G possibly damaging Het
L1td1 G A 4: 98,737,577 V604I probably benign Het
Lao1 A G 4: 118,968,368 T462A probably damaging Het
Lefty1 C A 1: 180,936,553 A86E probably damaging Het
Lmx1b T C 2: 33,639,510 Y79C Het
Lrp2 A G 2: 69,552,401 C47R probably damaging Het
Mrc2 A T 11: 105,347,639 N1204I probably benign Het
Ncf1 A C 5: 134,225,291 Y209* probably null Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr128 T A 17: 37,924,184 M206K probably benign Het
Olfr1368 A T 13: 21,142,283 M258K possibly damaging Het
Oxtr T G 6: 112,489,910 probably benign Het
Pcdhac1 T C 18: 37,091,889 V585A probably damaging Het
Pdcd11 T G 19: 47,108,580 L755R probably damaging Het
Pkhd1 A G 1: 20,288,237 V2705A probably damaging Het
Plch2 C A 4: 154,986,418 G1168V probably benign Het
Prpf39 T C 12: 65,042,781 Y98H possibly damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf10 T A 7: 112,955,531 D446E probably benign Het
Rgs13 T C 1: 144,140,744 Y87C probably damaging Het
Smpd3 G A 8: 106,255,745 R576C probably damaging Het
Srsf11 A T 3: 158,012,400 D382E unknown Het
Stpg1 T A 4: 135,533,797 M306K probably benign Het
Svil C T 18: 5,059,332 Q696* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Synj2 T C 17: 5,986,239 F161S possibly damaging Het
Tek T C 4: 94,849,800 Y696H probably damaging Het
Tgfbr1 A T 4: 47,405,555 D386V possibly damaging Het
Tgm4 G T 9: 123,061,845 G503V probably damaging Het
Tnni3k T C 3: 154,940,054 E461G probably damaging Het
Tom1l1 A T 11: 90,671,105 H232Q probably benign Het
Ubqln5 T C 7: 104,129,122 N165S probably benign Het
Vmn1r24 G A 6: 57,955,973 L187F probably benign Het
Vmn2r82 C T 10: 79,378,060 T160I probably damaging Het
Vmn2r96 G T 17: 18,597,988 G801V probably damaging Het
Vps39 A G 2: 120,342,025 S176P probably damaging Het
Vsig10 C A 5: 117,334,916 H191Q probably benign Het
Wtap G A 17: 12,967,601 S353L possibly damaging Het
Zmym4 T G 4: 126,923,160 R248S probably benign Het
Zscan10 A G 17: 23,610,037 S518G probably benign Het
Zscan29 A T 2: 121,166,395 Y282N probably damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
diabolical UTSW 8 111168743 missense probably damaging 1.00
BB007:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
BB017:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1899:Glg1 UTSW 8 111165674 missense probably benign 0.23
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2275:Glg1 UTSW 8 111168721 nonsense probably null
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111165691 missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6476:Glg1 UTSW 8 111200174 missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111178865 missense probably benign 0.19
R7930:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
R8182:Glg1 UTSW 8 111171297 missense possibly damaging 0.88
R8383:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R8905:Glg1 UTSW 8 111158036 missense probably damaging 0.99
R8954:Glg1 UTSW 8 111187895 missense probably damaging 1.00
R8958:Glg1 UTSW 8 111172484 nonsense probably null
R9023:Glg1 UTSW 8 111177748 missense probably damaging 0.99
R9113:Glg1 UTSW 8 111160820 intron probably benign
R9359:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9403:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9553:Glg1 UTSW 8 111200138 missense probably benign 0.04
R9622:Glg1 UTSW 8 111172501 missense probably damaging 1.00
R9714:Glg1 UTSW 8 111197669 missense probably damaging 1.00
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATAAGCCTTTCTACCCAGCATTC -3'
(R):5'- CTGAGAAGCAGGCCTATTCAG -3'

Sequencing Primer
(F):5'- ATGCTGTTATTCCTTTCCAAACC -3'
(R):5'- CCTATTCAGAGTCAGCAACGGG -3'
Posted On 2021-04-30