Incidental Mutation 'R8787:Prpf39'
ID 670720
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Name pre-mRNA processing factor 39
Synonyms Srcs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock # R8787 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 65036333-65063386 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65042781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 98 (Y98H)
Ref Sequence ENSEMBL: ENSMUSP00000112953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120580] [ENSMUST00000129956] [ENSMUST00000223315] [ENSMUST00000223341]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000120580
AA Change: Y98H

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597
AA Change: Y98H

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129956
AA Change: Y98H

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597
AA Change: Y98H

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223315
Predicted Effect probably benign
Transcript: ENSMUST00000223341
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,275,053 H511Y possibly damaging Het
Acp5 G A 9: 22,127,193 R271* probably null Het
Adamts20 A T 15: 94,286,413 V1503E possibly damaging Het
Adra2b A T 2: 127,364,497 E311D probably benign Het
Aldh18a1 T C 19: 40,557,786 I556V possibly damaging Het
Alox12 C A 11: 70,253,320 A116S probably benign Het
Alox5 G T 6: 116,413,141 A552E probably damaging Het
Angpt1 G T 15: 42,512,384 L159I probably damaging Het
Atp2b4 CTT CTTTTT 1: 133,701,747 probably benign Het
Bub1b T A 2: 118,631,824 L726I probably damaging Het
Ccdc78 A T 17: 25,787,833 T165S probably benign Het
Ccdc88b T C 19: 6,847,423 D1323G probably damaging Het
Chek1 A T 9: 36,713,737 C349* probably null Het
Clec1a A T 6: 129,451,654 L21Q possibly damaging Het
Col1a1 T C 11: 94,942,808 V445A possibly damaging Het
Efcab7 A G 4: 99,900,594 T313A probably null Het
Fads1 T A 19: 10,192,961 Y288* probably null Het
Fgb T A 3: 83,046,662 T90S probably benign Het
Glg1 C A 8: 111,161,482 V1026L probably damaging Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gm30302 T C 13: 49,785,228 Y1002C probably damaging Het
Hadh T A 3: 131,234,176 Y313F probably damaging Het
Htr4 A G 18: 62,437,782 I303V possibly damaging Het
Kcnn3 A G 3: 89,645,450 D487G possibly damaging Het
L1td1 G A 4: 98,737,577 V604I probably benign Het
Lao1 A G 4: 118,968,368 T462A probably damaging Het
Lefty1 C A 1: 180,936,553 A86E probably damaging Het
Lmx1b T C 2: 33,639,510 Y79C Het
Lrp2 A G 2: 69,552,401 C47R probably damaging Het
Mrc2 A T 11: 105,347,639 N1204I probably benign Het
Ncf1 A C 5: 134,225,291 Y209* probably null Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr128 T A 17: 37,924,184 M206K probably benign Het
Olfr1368 A T 13: 21,142,283 M258K possibly damaging Het
Oxtr T G 6: 112,489,910 probably benign Het
Pcdhac1 T C 18: 37,091,889 V585A probably damaging Het
Pdcd11 T G 19: 47,108,580 L755R probably damaging Het
Pkhd1 A G 1: 20,288,237 V2705A probably damaging Het
Plch2 C A 4: 154,986,418 G1168V probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf10 T A 7: 112,955,531 D446E probably benign Het
Rgs13 T C 1: 144,140,744 Y87C probably damaging Het
Smpd3 G A 8: 106,255,745 R576C probably damaging Het
Srsf11 A T 3: 158,012,400 D382E unknown Het
Stpg1 T A 4: 135,533,797 M306K probably benign Het
Svil C T 18: 5,059,332 Q696* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Synj2 T C 17: 5,986,239 F161S possibly damaging Het
Tek T C 4: 94,849,800 Y696H probably damaging Het
Tgfbr1 A T 4: 47,405,555 D386V possibly damaging Het
Tgm4 G T 9: 123,061,845 G503V probably damaging Het
Tnni3k T C 3: 154,940,054 E461G probably damaging Het
Tom1l1 A T 11: 90,671,105 H232Q probably benign Het
Ubqln5 T C 7: 104,129,122 N165S probably benign Het
Vmn1r24 G A 6: 57,955,973 L187F probably benign Het
Vmn2r82 C T 10: 79,378,060 T160I probably damaging Het
Vmn2r96 G T 17: 18,597,988 G801V probably damaging Het
Vps39 A G 2: 120,342,025 S176P probably damaging Het
Vsig10 C A 5: 117,334,916 H191Q probably benign Het
Wtap G A 17: 12,967,601 S353L possibly damaging Het
Zmym4 T G 4: 126,923,160 R248S probably benign Het
Zscan10 A G 17: 23,610,037 S518G probably benign Het
Zscan29 A T 2: 121,166,395 Y282N probably damaging Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65043263 missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65042481 unclassified probably benign
IGL01323:Prpf39 APN 12 65042724 missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65057736 missense probably benign 0.02
IGL02966:Prpf39 APN 12 65042779 missense probably benign 0.45
IGL03189:Prpf39 APN 12 65043302 nonsense probably null
IGL03357:Prpf39 APN 12 65061437 unclassified probably benign
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0328:Prpf39 UTSW 12 65043371 splice site probably benign
R0549:Prpf39 UTSW 12 65056256 missense probably benign 0.05
R0840:Prpf39 UTSW 12 65048206 missense probably benign 0.21
R1248:Prpf39 UTSW 12 65053966 splice site probably benign
R1322:Prpf39 UTSW 12 65042662 missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65053314 missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65057915 critical splice donor site probably null
R2232:Prpf39 UTSW 12 65044012 nonsense probably null
R2507:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2508:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2959:Prpf39 UTSW 12 65042523 missense probably damaging 1.00
R3117:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3118:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3980:Prpf39 UTSW 12 65061457 unclassified probably benign
R4407:Prpf39 UTSW 12 65056266 missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65042563 missense probably benign
R4926:Prpf39 UTSW 12 65044056 missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65048277 missense probably benign 0.29
R6248:Prpf39 UTSW 12 65042754 missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65042813 splice site probably null
R6614:Prpf39 UTSW 12 65042563 missense probably benign
R6749:Prpf39 UTSW 12 65056274 missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65042680 missense probably benign 0.03
R7023:Prpf39 UTSW 12 65053300 missense possibly damaging 0.94
R7503:Prpf39 UTSW 12 65053393 missense probably benign 0.04
R7532:Prpf39 UTSW 12 65053371 missense probably benign 0.00
R7608:Prpf39 UTSW 12 65053446 missense probably benign 0.41
R8286:Prpf39 UTSW 12 65056358 missense probably benign
R8439:Prpf39 UTSW 12 65055262 missense possibly damaging 0.95
R9101:Prpf39 UTSW 12 65043304 missense probably damaging 1.00
R9153:Prpf39 UTSW 12 65059897 missense probably damaging 0.99
R9448:Prpf39 UTSW 12 65061260 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTACGGAGATGGAGCAGTC -3'
(R):5'- ACATAATATTCAGCATCGTGTCCCC -3'

Sequencing Primer
(F):5'- ATGGAGCAGTCGCCTGATG -3'
(R):5'- AGCATCGTGTCCCCAGACTC -3'
Posted On 2021-04-30