Incidental Mutation 'R8787:Adamts20'
ID670725
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R8787 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94286413 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1503 (V1503E)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035342
AA Change: V1503E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: V1503E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,275,053 H511Y possibly damaging Het
Acp5 G A 9: 22,127,193 R271* probably null Het
Adra2b A T 2: 127,364,497 E311D probably benign Het
Aldh18a1 T C 19: 40,557,786 I556V possibly damaging Het
Alox12 C A 11: 70,253,320 A116S probably benign Het
Alox5 G T 6: 116,413,141 A552E probably damaging Het
Angpt1 G T 15: 42,512,384 L159I probably damaging Het
Atp2b4 CTT CTTTTT 1: 133,701,747 probably benign Het
Bub1b T A 2: 118,631,824 L726I probably damaging Het
Ccdc78 A T 17: 25,787,833 T165S probably benign Het
Ccdc88b T C 19: 6,847,423 D1323G probably damaging Het
Chek1 A T 9: 36,713,737 C349* probably null Het
Clec1a A T 6: 129,451,654 L21Q possibly damaging Het
Col1a1 T C 11: 94,942,808 V445A possibly damaging Het
Efcab7 A G 4: 99,900,594 T313A probably null Het
Fads1 T A 19: 10,192,961 Y288* probably null Het
Fgb T A 3: 83,046,662 T90S probably benign Het
Glg1 C A 8: 111,161,482 V1026L probably damaging Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gm30302 T C 13: 49,785,228 Y1002C probably damaging Het
Hadh T A 3: 131,234,176 Y313F probably damaging Het
Htr4 A G 18: 62,437,782 I303V possibly damaging Het
Kcnn3 A G 3: 89,645,450 D487G possibly damaging Het
L1td1 G A 4: 98,737,577 V604I probably benign Het
Lao1 A G 4: 118,968,368 T462A probably damaging Het
Lefty1 C A 1: 180,936,553 A86E probably damaging Het
Lmx1b T C 2: 33,639,510 Y79C Het
Lrp2 A G 2: 69,552,401 C47R probably damaging Het
Mrc2 A T 11: 105,347,639 N1204I probably benign Het
Ncf1 A C 5: 134,225,291 Y209* probably null Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr128 T A 17: 37,924,184 M206K probably benign Het
Olfr1368 A T 13: 21,142,283 M258K possibly damaging Het
Pcdhac1 T C 18: 37,091,889 V585A probably damaging Het
Pdcd11 T G 19: 47,108,580 L755R probably damaging Het
Pkhd1 A G 1: 20,288,237 V2705A probably damaging Het
Plch2 C A 4: 154,986,418 G1168V probably benign Het
Prpf39 T C 12: 65,042,781 Y98H possibly damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf10 T A 7: 112,955,531 D446E probably benign Het
Rgs13 T C 1: 144,140,744 Y87C probably damaging Het
Smpd3 G A 8: 106,255,745 R576C probably damaging Het
Srsf11 A T 3: 158,012,400 D382E unknown Het
Stpg1 T A 4: 135,533,797 M306K probably benign Het
Svil C T 18: 5,059,332 Q696* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Synj2 T C 17: 5,986,239 F161S possibly damaging Het
Tek T C 4: 94,849,800 Y696H probably damaging Het
Tgfbr1 A T 4: 47,405,555 D386V possibly damaging Het
Tgm4 G T 9: 123,061,845 G503V probably damaging Het
Tnni3k T C 3: 154,940,054 E461G probably damaging Het
Tom1l1 A T 11: 90,671,105 H232Q probably benign Het
Ubqln5 T C 7: 104,129,122 N165S probably benign Het
Vmn1r24 G A 6: 57,955,973 L187F probably benign Het
Vmn2r82 C T 10: 79,378,060 T160I probably damaging Het
Vmn2r96 G T 17: 18,597,988 G801V probably damaging Het
Vps39 A G 2: 120,342,025 S176P probably damaging Het
Vsig10 C A 5: 117,334,916 H191Q probably benign Het
Wtap G A 17: 12,967,601 S353L possibly damaging Het
Zmym4 T G 4: 126,923,160 R248S probably benign Het
Zscan10 A G 17: 23,610,037 S518G probably benign Het
Zscan29 A T 2: 121,166,395 Y282N probably damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 intron probably benign
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 intron probably benign
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense probably damaging 1.00
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 splice site probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
R7186:Adamts20 UTSW 15 94322808 missense possibly damaging 0.76
R7263:Adamts20 UTSW 15 94322891 missense possibly damaging 0.52
R7441:Adamts20 UTSW 15 94353673 missense probably damaging 1.00
R7519:Adamts20 UTSW 15 94325988 missense possibly damaging 0.64
R7747:Adamts20 UTSW 15 94291587 nonsense probably null
R7770:Adamts20 UTSW 15 94333698 missense probably benign 0.02
R7816:Adamts20 UTSW 15 94322844 missense probably benign 0.00
R7827:Adamts20 UTSW 15 94325933 missense probably damaging 1.00
R7853:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R7894:Adamts20 UTSW 15 94351760 missense probably damaging 1.00
R7951:Adamts20 UTSW 15 94341066 missense probably damaging 1.00
R8233:Adamts20 UTSW 15 94291652 missense probably benign 0.19
R8458:Adamts20 UTSW 15 94353640 missense probably benign 0.02
R8709:Adamts20 UTSW 15 94341066 missense probably damaging 1.00
R8719:Adamts20 UTSW 15 94344022 missense probably damaging 0.99
R8728:Adamts20 UTSW 15 94331400 missense probably benign 0.00
R8801:Adamts20 UTSW 15 94360609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTCACACCGTGACGTC -3'
(R):5'- ATGCCAGGCCATGTCTATAAC -3'

Sequencing Primer
(F):5'- CATACGCAGACACGAGATGATGTTAC -3'
(R):5'- CAGGCCATGTCTATAACAAATAAGG -3'
Posted On2021-04-30