Incidental Mutation 'R8788:Kif26b'
ID670740
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8788 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 178529525 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161017]
Predicted Effect probably benign
Transcript: ENSMUST00000161017
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,470,987 *252W probably null Het
Ank3 A T 10: 69,882,426 L502F unknown Het
Btnl9 T A 11: 49,175,787 M336L probably benign Het
C77080 A G 4: 129,225,950 V97A probably benign Het
Cd72 T C 4: 43,450,185 E241G probably benign Het
Cdh23 T A 10: 60,488,593 N296I probably damaging Het
Celf6 C A 9: 59,578,467 S30R possibly damaging Het
Crxos T C 7: 15,898,574 Y102H probably benign Het
Csmd3 A T 15: 47,607,117 S2477T Het
Evi2a T A 11: 79,527,705 R26S probably benign Het
Ezr T C 17: 6,753,993 M182V probably benign Het
Fat2 G T 11: 55,281,103 A2928D possibly damaging Het
Fetub A T 16: 22,939,432 K322* probably null Het
Fscb T C 12: 64,471,621 T1024A unknown Het
Gdpd1 A G 11: 87,059,492 V85A probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm6614 A T 6: 141,987,844 V425D probably benign Het
Gpr182 T C 10: 127,750,660 T141A probably benign Het
Inpp5d G A 1: 87,683,762 G312D probably damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Maf T A 8: 115,705,873 I331F probably damaging Het
Mark3 C A 12: 111,646,690 S529R probably benign Het
Mrps30 T C 13: 118,387,002 E78G possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1221 T C 2: 89,112,282 T77A probably benign Het
Pcdh12 G A 18: 38,283,056 L339F probably benign Het
Pdgfd A G 9: 6,377,000 S365G probably benign Het
Piezo1 T C 8: 122,501,794 M281V Het
Prkg2 C T 5: 98,969,980 E501K probably damaging Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rfx7 T C 9: 72,617,513 S662P probably benign Het
Ric8a A G 7: 140,858,893 T252A probably benign Het
Sbf1 C T 15: 89,301,859 R984H probably damaging Het
Sel1l3 G T 5: 53,174,806 Y412* probably null Het
Slc17a6 G A 7: 51,649,160 A224T probably damaging Het
Smarca4 T C 9: 21,638,728 I378T probably damaging Het
Tatdn1 T C 15: 58,890,694 *265W probably null Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tcl1b2 T C 12: 105,147,121 L11P probably benign Het
Thrb A G 14: 18,002,558 E119G probably damaging Het
Tll2 T C 19: 41,121,375 T317A probably benign Het
Tob2 AGATGATGA AGATGA 15: 81,851,727 probably benign Het
Upk1b A G 16: 38,787,101 L88P probably damaging Het
Uri1 T C 7: 37,961,578 I30V Het
Ush2a A T 1: 188,743,619 R2918* probably null Het
Vax1 T C 19: 59,169,815 D72G unknown Het
Vmn2r38 C A 7: 9,075,483 M633I probably benign Het
Vmn2r95 A G 17: 18,451,528 D581G probably benign Het
Vps13d A G 4: 145,086,735 F3324L Het
Xrcc6 C T 15: 82,027,382 L309F probably damaging Het
Xrra1 A G 7: 99,906,554 Y376C probably benign Het
Zfp329 T C 7: 12,810,563 T345A possibly damaging Het
Zfp574 T A 7: 25,080,391 N279K unknown Het
Zfp804b T C 5: 6,772,635 M143V probably benign Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R7954:Kif26b UTSW 1 178869379 missense probably damaging 0.99
R7960:Kif26b UTSW 1 178678919 missense probably damaging 1.00
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
R8152:Kif26b UTSW 1 178679229 missense possibly damaging 0.46
R8320:Kif26b UTSW 1 178884076 critical splice donor site probably null
R8360:Kif26b UTSW 1 178916373 missense probably benign 0.18
R8428:Kif26b UTSW 1 178917358 missense probably benign 0.09
R8670:Kif26b UTSW 1 178913784 missense probably damaging 1.00
R8737:Kif26b UTSW 1 178864865 missense probably damaging 0.99
R8854:Kif26b UTSW 1 178916383 missense possibly damaging 0.93
R8870:Kif26b UTSW 1 178865029 missense probably damaging 1.00
R8963:Kif26b UTSW 1 178916149 missense probably benign 0.00
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAGAACCACCAGCCGTTC -3'
(R):5'- CTGAAGACATTCCCGTAGCC -3'

Sequencing Primer
(F):5'- CCAACCTTTCCTGCAAATTGGTG -3'
(R):5'- ATTCCCGTAGCCAGGCGAG -3'
Posted On2021-04-30