Incidental Mutation 'R8788:Xrra1'
ID670758
Institutional Source Beutler Lab
Gene Symbol Xrra1
Ensembl Gene ENSMUSG00000035211
Gene NameX-ray radiation resistance associated 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8788 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location99859116-99917822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99906554 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 376 (Y376C)
Ref Sequence ENSEMBL: ENSMUSP00000035929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036155] [ENSMUST00000207855]
Predicted Effect probably benign
Transcript: ENSMUST00000036155
AA Change: Y376C

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035929
Gene: ENSMUSG00000035211
AA Change: Y376C

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Blast:LRR 144 168 4e-6 BLAST
LRR 191 214 2.02e-1 SMART
LRR 232 253 1.67e2 SMART
LRR 257 278 6.41e1 SMART
LRR 371 398 4.09e1 SMART
low complexity region 748 756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207855
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,470,987 *252W probably null Het
Ank3 A T 10: 69,882,426 L502F unknown Het
Btnl9 T A 11: 49,175,787 M336L probably benign Het
C77080 A G 4: 129,225,950 V97A probably benign Het
Cd72 T C 4: 43,450,185 E241G probably benign Het
Cdh23 T A 10: 60,488,593 N296I probably damaging Het
Celf6 C A 9: 59,578,467 S30R possibly damaging Het
Crxos T C 7: 15,898,574 Y102H probably benign Het
Csmd3 A T 15: 47,607,117 S2477T Het
Evi2a T A 11: 79,527,705 R26S probably benign Het
Ezr T C 17: 6,753,993 M182V probably benign Het
Fat2 G T 11: 55,281,103 A2928D possibly damaging Het
Fetub A T 16: 22,939,432 K322* probably null Het
Fscb T C 12: 64,471,621 T1024A unknown Het
Gdpd1 A G 11: 87,059,492 V85A probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm6614 A T 6: 141,987,844 V425D probably benign Het
Gpr182 T C 10: 127,750,660 T141A probably benign Het
Inpp5d G A 1: 87,683,762 G312D probably damaging Het
Kif26b G A 1: 178,529,525 probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Maf T A 8: 115,705,873 I331F probably damaging Het
Mark3 C A 12: 111,646,690 S529R probably benign Het
Mrps30 T C 13: 118,387,002 E78G possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1221 T C 2: 89,112,282 T77A probably benign Het
Pcdh12 G A 18: 38,283,056 L339F probably benign Het
Pdgfd A G 9: 6,377,000 S365G probably benign Het
Piezo1 T C 8: 122,501,794 M281V Het
Prkg2 C T 5: 98,969,980 E501K probably damaging Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rfx7 T C 9: 72,617,513 S662P probably benign Het
Ric8a A G 7: 140,858,893 T252A probably benign Het
Sbf1 C T 15: 89,301,859 R984H probably damaging Het
Sel1l3 G T 5: 53,174,806 Y412* probably null Het
Slc17a6 G A 7: 51,649,160 A224T probably damaging Het
Smarca4 T C 9: 21,638,728 I378T probably damaging Het
Tatdn1 T C 15: 58,890,694 *265W probably null Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tcl1b2 T C 12: 105,147,121 L11P probably benign Het
Thrb A G 14: 18,002,558 E119G probably damaging Het
Tll2 T C 19: 41,121,375 T317A probably benign Het
Tob2 AGATGATGA AGATGA 15: 81,851,727 probably benign Het
Upk1b A G 16: 38,787,101 L88P probably damaging Het
Uri1 T C 7: 37,961,578 I30V Het
Ush2a A T 1: 188,743,619 R2918* probably null Het
Vax1 T C 19: 59,169,815 D72G unknown Het
Vmn2r38 C A 7: 9,075,483 M633I probably benign Het
Vmn2r95 A G 17: 18,451,528 D581G probably benign Het
Vps13d A G 4: 145,086,735 F3324L Het
Xrcc6 C T 15: 82,027,382 L309F probably damaging Het
Zfp329 T C 7: 12,810,563 T345A possibly damaging Het
Zfp574 T A 7: 25,080,391 N279K unknown Het
Zfp804b T C 5: 6,772,635 M143V probably benign Het
Other mutations in Xrra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Xrra1 APN 7 99875194 missense possibly damaging 0.76
IGL01938:Xrra1 APN 7 99879469 critical splice donor site probably null
IGL02064:Xrra1 APN 7 99914204 missense probably damaging 1.00
IGL02286:Xrra1 APN 7 99914227 missense possibly damaging 0.62
IGL02415:Xrra1 APN 7 99915943 missense probably benign
R0332:Xrra1 UTSW 7 99876242 missense probably damaging 1.00
R0465:Xrra1 UTSW 7 99879371 missense probably benign 0.00
R0533:Xrra1 UTSW 7 99875145 splice site probably null
R0601:Xrra1 UTSW 7 99910968 missense possibly damaging 0.95
R1539:Xrra1 UTSW 7 99871357 missense probably damaging 1.00
R1672:Xrra1 UTSW 7 99898440 missense probably benign 0.00
R1687:Xrra1 UTSW 7 99876244 missense probably damaging 1.00
R1962:Xrra1 UTSW 7 99911020 missense probably damaging 1.00
R2504:Xrra1 UTSW 7 99897596 missense probably damaging 1.00
R4765:Xrra1 UTSW 7 99906568 missense probably benign 0.19
R4967:Xrra1 UTSW 7 99906523 missense probably damaging 0.99
R5213:Xrra1 UTSW 7 99898483 missense possibly damaging 0.47
R5663:Xrra1 UTSW 7 99886043 missense probably damaging 1.00
R5986:Xrra1 UTSW 7 99876255 missense probably benign 0.40
R6256:Xrra1 UTSW 7 99914464 missense probably damaging 0.99
R6269:Xrra1 UTSW 7 99917472 missense probably damaging 1.00
R7234:Xrra1 UTSW 7 99914249 missense possibly damaging 0.49
R7316:Xrra1 UTSW 7 99876216 critical splice acceptor site probably null
R7655:Xrra1 UTSW 7 99910982 missense probably benign 0.10
R7656:Xrra1 UTSW 7 99910982 missense probably benign 0.10
R8688:Xrra1 UTSW 7 99906545 missense probably damaging 1.00
X0017:Xrra1 UTSW 7 99916100 missense probably damaging 1.00
X0021:Xrra1 UTSW 7 99898486 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCTACAGAGGCCTTTCACCATAC -3'
(R):5'- GCATGGAGACTAGTGTGTGAC -3'

Sequencing Primer
(F):5'- GAGGCCTTTCACCATACCCAATAGG -3'
(R):5'- CTAGTGTGTGACAAGTGACAACCTTG -3'
Posted On2021-04-30