Incidental Mutation 'R8788:Btnl9'
ID670770
Institutional Source Beutler Lab
Gene Symbol Btnl9
Ensembl Gene ENSMUSG00000040283
Gene Namebutyrophilin-like 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8788 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49165585-49187159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49175787 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 336 (M336L)
Ref Sequence ENSEMBL: ENSMUSP00000066598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000066531] [ENSMUST00000153999]
Predicted Effect probably benign
Transcript: ENSMUST00000046522
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066531
AA Change: M336L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066598
Gene: ENSMUSG00000040283
AA Change: M336L

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_3 155 231 1e-4 PFAM
Pfam:C2-set_2 156 238 2.2e-6 PFAM
transmembrane domain 360 382 N/A INTRINSIC
PRY 419 462 3.61e-2 SMART
SPRY 463 588 1.3e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153999
SMART Domains Protein: ENSMUSP00000120530
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
transmembrane domain 165 187 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,470,987 *252W probably null Het
Ank3 A T 10: 69,882,426 L502F unknown Het
C77080 A G 4: 129,225,950 V97A probably benign Het
Cd72 T C 4: 43,450,185 E241G probably benign Het
Cdh23 T A 10: 60,488,593 N296I probably damaging Het
Celf6 C A 9: 59,578,467 S30R possibly damaging Het
Crxos T C 7: 15,898,574 Y102H probably benign Het
Csmd3 A T 15: 47,607,117 S2477T Het
Evi2a T A 11: 79,527,705 R26S probably benign Het
Ezr T C 17: 6,753,993 M182V probably benign Het
Fat2 G T 11: 55,281,103 A2928D possibly damaging Het
Fetub A T 16: 22,939,432 K322* probably null Het
Fscb T C 12: 64,471,621 T1024A unknown Het
Gdpd1 A G 11: 87,059,492 V85A probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm6614 A T 6: 141,987,844 V425D probably benign Het
Gpr182 T C 10: 127,750,660 T141A probably benign Het
Inpp5d G A 1: 87,683,762 G312D probably damaging Het
Kif26b G A 1: 178,529,525 probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Maf T A 8: 115,705,873 I331F probably damaging Het
Mark3 C A 12: 111,646,690 S529R probably benign Het
Mrps30 T C 13: 118,387,002 E78G possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1221 T C 2: 89,112,282 T77A probably benign Het
Pcdh12 G A 18: 38,283,056 L339F probably benign Het
Pdgfd A G 9: 6,377,000 S365G probably benign Het
Piezo1 T C 8: 122,501,794 M281V Het
Prkg2 C T 5: 98,969,980 E501K probably damaging Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rfx7 T C 9: 72,617,513 S662P probably benign Het
Ric8a A G 7: 140,858,893 T252A probably benign Het
Sbf1 C T 15: 89,301,859 R984H probably damaging Het
Sel1l3 G T 5: 53,174,806 Y412* probably null Het
Slc17a6 G A 7: 51,649,160 A224T probably damaging Het
Smarca4 T C 9: 21,638,728 I378T probably damaging Het
Tatdn1 T C 15: 58,890,694 *265W probably null Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tcl1b2 T C 12: 105,147,121 L11P probably benign Het
Thrb A G 14: 18,002,558 E119G probably damaging Het
Tll2 T C 19: 41,121,375 T317A probably benign Het
Tob2 AGATGATGA AGATGA 15: 81,851,727 probably benign Het
Upk1b A G 16: 38,787,101 L88P probably damaging Het
Uri1 T C 7: 37,961,578 I30V Het
Ush2a A T 1: 188,743,619 R2918* probably null Het
Vax1 T C 19: 59,169,815 D72G unknown Het
Vmn2r38 C A 7: 9,075,483 M633I probably benign Het
Vmn2r95 A G 17: 18,451,528 D581G probably benign Het
Vps13d A G 4: 145,086,735 F3324L Het
Xrcc6 C T 15: 82,027,382 L309F probably damaging Het
Xrra1 A G 7: 99,906,554 Y376C probably benign Het
Zfp329 T C 7: 12,810,563 T345A possibly damaging Het
Zfp574 T A 7: 25,080,391 N279K unknown Het
Zfp804b T C 5: 6,772,635 M143V probably benign Het
Other mutations in Btnl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Btnl9 APN 11 49175691 missense probably damaging 1.00
IGL01923:Btnl9 APN 11 49180582 missense probably benign 0.00
IGL02129:Btnl9 APN 11 49169273 missense probably damaging 1.00
IGL02248:Btnl9 APN 11 49180798 missense probably benign 0.27
IGL02795:Btnl9 APN 11 49174867 splice site probably benign
IGL02889:Btnl9 APN 11 49178777 missense probably damaging 1.00
IGL02796:Btnl9 UTSW 11 49169181 missense probably damaging 0.99
R0084:Btnl9 UTSW 11 49178779 missense possibly damaging 0.91
R0362:Btnl9 UTSW 11 49169616 missense possibly damaging 0.73
R0417:Btnl9 UTSW 11 49175595 missense probably damaging 1.00
R1199:Btnl9 UTSW 11 49180747 missense probably damaging 1.00
R1260:Btnl9 UTSW 11 49169544 missense probably damaging 0.98
R1802:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R2000:Btnl9 UTSW 11 49169121 missense probably benign 0.04
R2068:Btnl9 UTSW 11 49169563 missense probably damaging 0.98
R2130:Btnl9 UTSW 11 49180696 missense probably damaging 0.99
R2142:Btnl9 UTSW 11 49170626 splice site probably null
R2229:Btnl9 UTSW 11 49169118 missense probably damaging 1.00
R2255:Btnl9 UTSW 11 49169316 nonsense probably null
R2386:Btnl9 UTSW 11 49178775 missense probably damaging 1.00
R3177:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3277:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3835:Btnl9 UTSW 11 49180685 missense probably damaging 1.00
R5287:Btnl9 UTSW 11 49169607 missense probably benign 0.20
R5352:Btnl9 UTSW 11 49178840 missense probably benign 0.01
R5433:Btnl9 UTSW 11 49176003 intron probably benign
R5490:Btnl9 UTSW 11 49169568 missense probably damaging 1.00
R5576:Btnl9 UTSW 11 49178885 missense probably benign 0.00
R6008:Btnl9 UTSW 11 49182965 critical splice donor site probably null
R6770:Btnl9 UTSW 11 49175565 splice site probably null
R7126:Btnl9 UTSW 11 49169255 missense probably damaging 1.00
R7276:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R7787:Btnl9 UTSW 11 49176039 missense unknown
R7923:Btnl9 UTSW 11 49180738 missense probably damaging 0.97
R8050:Btnl9 UTSW 11 49175615 missense probably benign 0.25
R8558:Btnl9 UTSW 11 49180792 missense probably benign 0.00
X0026:Btnl9 UTSW 11 49169241 missense probably damaging 1.00
Z1192:Btnl9 UTSW 11 49175978 missense unknown
Predicted Primers PCR Primer
(F):5'- TCATACCTTGGAAGCTCCGC -3'
(R):5'- GCAGGGACCCATCCTTTATC -3'

Sequencing Primer
(F):5'- GCTCCGCAGCTTGTAAAAATATCG -3'
(R):5'- AGGGACCCATCCTTTATCTTCAATTC -3'
Posted On2021-04-30